View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4455_low_6 (Length: 241)
Name: NF4455_low_6
Description: NF4455
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4455_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 166
Target Start/End: Original strand, 41745933 - 41746088
Alignment:
| Q |
11 |
attattctgatcaaggtgtgggaggttgaaatcaaagttgaaattttcaagatcatcgaagtcattcatgtaaaaatgattactttggtatgaaaattga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41745933 |
attattctgatcaaggtgtgggaggttgaaatcaaagttgaaattttcaagatcatcgaagtcattcatgtaaaaatgattactttggtatgaaaattga |
41746032 |
T |
|
| Q |
111 |
gttgcccaatcaaactcaaagaaatcatcaaatggcgcaatacccatgattctgtt |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41746033 |
gttgcccaatcaaactcaaagaaatcatcaaatggcgcaatacccatgattctgtt |
41746088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 11 - 161
Target Start/End: Complemental strand, 29589527 - 29589377
Alignment:
| Q |
11 |
attattctgatcaaggtgtgggaggttgaaatcaaagttgaaattttcaagatcatcgaagtcattcatgtaaaaatgattactttggtatgaaaattga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||| |
|
|
| T |
29589527 |
attattctgatcaaggtgtgggaggttgaaattaaagttgaaattttcaagatcatcgaagtcattcttgtaaatatgattacttcggtatgaaaattga |
29589428 |
T |
|
| Q |
111 |
gttgcccaatcaaactcaaagaaatcatcaaatggcgcaatacccatgatt |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29589427 |
gttgcccaatcaaactcaaagaaatcatcaaatggcgcaatacccatgatt |
29589377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University