View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4456_high_3 (Length: 244)
Name: NF4456_high_3
Description: NF4456
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4456_high_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 36680607 - 36680825
Alignment:
| Q |
1 |
ttttaaaaagtaataatttaagcaagcaaaatattcatggttatgttctaagaaattgttttccgatgggtgcatgaaatgtaaacgaggtttggtagat |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36680607 |
ttttcaaaagtaataatttaagcaagcaaaatattcatgtttatgttctaagaaattgttttccgatgggtgcatgaaatgtaaacgaggtttggtagat |
36680706 |
T |
 |
| Q |
101 |
tataaaaacacatgagctggtaattggtttggtagtagtccgacacctactgacaactccaatgggcatgtcctatggtagggcaaaccctagggcccgg |
200 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36680707 |
tataaaaacacatttgctggtaattggtttggtagtagtccgacacctactgacaactccaatgggcatgtcctatggtagggcaaaccctagggcccgg |
36680806 |
T |
 |
| Q |
201 |
agaagcccatgcatgaagc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
36680807 |
agaagcccatgcatgaagc |
36680825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University