View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_high_30 (Length: 307)
Name: NF4458_high_30
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_high_30 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 12 - 290
Target Start/End: Original strand, 15097184 - 15097462
Alignment:
| Q |
12 |
atgagataaggtccggacataagtttttaaggcggagctggttttattgggtttgagttagaccaaacccgaacttttaagaatctggtgtgagtggcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15097184 |
atgagataaggtccggacataagtttttaaggtggagttggttttattgggtttgagttagaccaaacccgaacttttaagaatctggtgtgagtggtaa |
15097283 |
T |
|
| Q |
112 |
gcaacgagtctcttaaatatgtggtcatgagtttgatttctgattcatacatatacaatttcactttttgatagagtaaatctttaaatgtgtactttag |
211 |
Q |
| |
|
||| |||||||||||| |||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
15097284 |
gcagcgagtctcttaagtatgtggttatgagtttgatttctagttcatacatatacaatttcactttttgatagagtaaacctttaaatgtgtactctag |
15097383 |
T |
|
| Q |
212 |
atttcggaagggattagtctttgtagtcgtgtagttatcgaatcccccaatgttgtcatgattttgatttctaattcat |
290 |
Q |
| |
|
|| | |||||||||||||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15097384 |
atcttagaagggattagtctttgtagtcgtgtaggtatcgagtcccccaatgttgtcatggttttgatttctaattcat |
15097462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 15097433 - 15097501
Alignment:
| Q |
130 |
atgtggtcatgagtttgatttctgattcatacatatacaatttcactttttgatagagtaaatctttaa |
198 |
Q |
| |
|
|||| |||||| |||||||||| ||||||||||||| || ||||||||||||| |||||| |||||| |
|
|
| T |
15097433 |
atgttgtcatggttttgatttctaattcatacatataaaagttcactttttgatgaagtaaacctttaa |
15097501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University