View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_high_55 (Length: 207)
Name: NF4458_high_55
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_high_55 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 17 - 196
Target Start/End: Original strand, 42935728 - 42935907
Alignment:
| Q |
17 |
agaagctgataggtgacaattttgagctttgaggatgcgttttctacagtgatgctgacttattctcccctctttaatcgttgaaaatggtattgaatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42935728 |
agaagctgataggtgacaattttgagctttgaggatgcgttttctacagtgatgctgagttattctcccctctttaatcgttgaaaatggtattgaatgt |
42935827 |
T |
|
| Q |
117 |
tatttgaatgtcctaggtcgtgacttggtcaacaagtcttgcttccttataagatattagtccatcttgcacctttgctt |
196 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42935828 |
tatttgagtgtcctaggtcatgacttggtcaacaagtcttgcttccttataagatattagtccatcttgcaccattgctt |
42935907 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University