View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_25 (Length: 369)
Name: NF4458_low_25
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_25 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 20 - 151
Target Start/End: Original strand, 10028991 - 10029122
Alignment:
| Q |
20 |
ctgtgttggatctttgttgttgcttccattcaggttttcggtttctgccgtgtgtttttcatcagatgtggcttttgctgatgtttgttcgctgcataga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10028991 |
ctgtgttggatctttgttgttgcttccattcaggttttcggtttctgccttgtgtttttcatcagatgtggcttttgctgatgtttgttcgctgcataga |
10029090 |
T |
|
| Q |
120 |
gtgttttctggggtgcaaggagctgggtttta |
151 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |
|
|
| T |
10029091 |
gtgttttctagggtgcaaggagctgggtttta |
10029122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 266 - 357
Target Start/End: Original strand, 10029237 - 10029328
Alignment:
| Q |
266 |
ctgttggtttcacgatactaccttaaattgtgtaaggtagactataatttatgccacctccaagataaaatagtccagttcactatgatgat |
357 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10029237 |
ctgttggtttcacgatactaccttaaattgtgtaaggtagactataatttatgccgcctccaagataaaatagtccagttcactattatgat |
10029328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 92 - 126
Target Start/End: Original strand, 10641847 - 10641881
Alignment:
| Q |
92 |
ttttgctgatgtttgttcgctgcatagagtgtttt |
126 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10641847 |
ttttgctgatgtttgtttgctgcatagagtgtttt |
10641881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University