View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_37 (Length: 299)
Name: NF4458_low_37
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 272
Target Start/End: Original strand, 45654165 - 45654418
Alignment:
| Q |
19 |
aaaaagtctccaaaagaggagccattatatcccaaaaaccacaccaaatatgattttcagtaggtaaacagattagaaaattatatgcatctgcaaacct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
45654165 |
aaaaagtctccaaaagaggagccattatatcccaaaaaccacaccaaatatgattttcagtaggtaaacagattataaaattatatgcatctgcaaacct |
45654264 |
T |
 |
| Q |
119 |
aacagtaattaaaacgattttcattaattaaattggattaagacataatagtaatatgtgaaagagggaaggaacgaaccattgctctttgtggaggtgg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654265 |
aacagtaattaaaacgattttcattaattaaattggattaagacataatagtaatatgtgaaagagggaaggaacgaaccattgctctttgtggaggtgg |
45654364 |
T |
 |
| Q |
219 |
atgcgacgatgtttagagggatcaagatcaacaacatcgacatcgtcatcggcg |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654365 |
atgcgacgatgtttagagggatcaagatcaacaacatcgacatcgtcatcggcg |
45654418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University