View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_38 (Length: 299)
Name: NF4458_low_38
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_38 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 20 - 298
Target Start/End: Original strand, 26578155 - 26578433
Alignment:
| Q |
20 |
ttcacgaaacccagtatactattaattcattgccagaccatagcctcttacgttcaaaatatatagatcaaccaatcattttaatctacaatatatcacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26578155 |
ttcacgaaacccagtatactattaattcattgccagaccatagcctcttacgttcaaaatatatagatcaaccaatcattttaatctacaatatatcacg |
26578254 |
T |
|
| Q |
120 |
tcatcatcctgtaacgtctatgagtagggctagggcacaggccattctatgctatgctacgctgtgagtatatgtcagcctgcagcacctggtcagcttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26578255 |
tcatcatcctgtaacgtctatgagtagggctagggcacaggccattctatgctatgctacgctgtgagtatatgtcagcctgcagcacctggtcagcttg |
26578354 |
T |
|
| Q |
220 |
cttcatggacacagtgggtggccctaactccatccaccccactcgtgcacgtcattcaattcatattcttctctctcga |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
26578355 |
cttcatggacacagtgggtggccctaactccatccaccccactcgtgcacgtcattcaattcatattctcatctctcga |
26578433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University