View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_39 (Length: 298)
Name: NF4458_low_39
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 9 - 276
Target Start/End: Original strand, 38345345 - 38345613
Alignment:
| Q |
9 |
agcagagagtgaaaaagaataagaggtttaaaattaagtagtaatgaatgaatatgcgtcgaaaatctaaacatggccccctttcttttctaccctttat |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38345345 |
agcagagagtgaaaaagaataagaggtttaaaattaagtagtaatgaatgaatatgcgtcgaaaatctaaacatggccccctttcttttcttccctttat |
38345444 |
T |
|
| Q |
109 |
tagcactattttttgttcttgttccagaacccaataattgtagcctcggtgactttctgtccctcttagtaccctcttgaattgttcaactcacaaccct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38345445 |
tagcactattttttgttcttgttccagaacccaataattgtagcctcggtgactttctgtccctcttagtaccctcttgaattgttcaactcacaaccct |
38345544 |
T |
|
| Q |
209 |
atatctgtttgtctaatcttaattaat-ataggagtacttagtgtatgtttgctttttaattttaagga |
276 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38345545 |
atatctgtttgtctaatcttaattaataataggagtacttagtgtatgtttgcttttaaattttaagga |
38345613 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University