View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_42 (Length: 268)
Name: NF4458_low_42
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_42 |
 |  |
|
| [»] chr2 (23 HSPs) |
 |  |
|
| [»] scaffold1176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0223 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (2 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 60; Significance: 1e-25; HSPs: 23)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 197 - 268
Target Start/End: Complemental strand, 21792627 - 21792556
Alignment:
| Q |
197 |
acctaaatgagtttttgtaaccataagaatgtctaaataaattaaatataaacatgtatcacctttctgact |
268 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21792627 |
acctaaatgggtttttgtaaccataaggatgtctaaataaattaaatataaacatgtatcacctttccgact |
21792556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 10543749 - 10543834
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
10543749 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
10543834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 14530369 - 14530454
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| | |||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
14530369 |
taaggctacgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
14530454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 11514487 - 11514569
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| |||| |||||||||||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
11514487 |
taaggctgcgtacaatacaccaa--atggtgggaccctt-cccagaccctgcgtatgcgggagctttagtgcaccggattgccctt |
11514569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 85 - 164
Target Start/End: Complemental strand, 31158519 - 31158440
Alignment:
| Q |
85 |
tgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||| ||||| |||| ||||| || |||||||||||||| ||||||||||||||| | |||| ||||| |||| |
|
|
| T |
31158519 |
tgcatacaataaaccaaaaatggtgggaccccttcccagaccctgcgtatgcgggagctttagtacacctgattgtcctt |
31158440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 31525779 - 31525838
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccc |
162 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
31525779 |
aatgatgggaccctttgccagaccctgcatatgcgggagctttagtgtaccggattgccc |
31525838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 5841079 - 5841153
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||| ||| ||||||||| |||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
5841079 |
taaggatgcgtacaatacatcaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc |
5841153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 9671230 - 9671313
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
9671230 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
9671313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 10546214 - 10546297
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
10546214 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
10546297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 117 - 164
Target Start/End: Original strand, 30826122 - 30826169
Alignment:
| Q |
117 |
ttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
30826122 |
ttcccagaccctacatatgcgggagctttagtgcaccagattgtcctt |
30826169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 8455400 - 8455317
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || ||||| |||||||| ||||| ||||||||| |||||| | |||||||| |
|
|
| T |
8455400 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttgccctt |
8455317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 14444779 - 14444862
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| ||| ||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
14444779 |
taaggctgtgtacgatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctt |
14444862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 21779345 - 21779262
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
21779345 |
taaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
21779262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 152
Target Start/End: Original strand, 24890462 - 24890533
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| || ||||| |||||||| ||||| ||||||||| ||||| |
|
|
| T |
24890462 |
taaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcac |
24890533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 25249822 - 25249739
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||| ||||| ||||||| |||||| |||||||| |||||| | |||||||| |
|
|
| T |
25249822 |
taaggctgcgtacaatacacca--aatggtgggatcccttcccgaaccctgcgtatgcgtgagctttagtgcaccgggttgccctt |
25249739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 24200709 - 24200624
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| ||||||| |||| | |||||||| |||||| | |||||||| |
|
|
| T |
24200709 |
taaggctgcgtacaatacaccaaaaatggtgggaacccttcccggaccctgagtatgtgagagctttagtgcaccgggttgccctt |
24200624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 19977799 - 19977715
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||| ||||||||||||| ||| |||||||| ||||| ||| || ||||||||||||||| ||||||||||| ||||| |
|
|
| T |
19977799 |
ataaggttgcgtacaatacaccaa--atggtgggatcccttcccgaaccttgtgtatgcgggagctttagtgcaccagattaccctt |
19977715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 114 - 152
Target Start/End: Original strand, 31523315 - 31523353
Alignment:
| Q |
114 |
cctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
31523315 |
cctttcccaaaccctgcatatgcgggagctttagtgcac |
31523353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 36871543 - 36871625
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||| ||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
36871543 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggacc-tgcgtatgcgggagctttagtgcaccgggttgccctt |
36871625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 164
Target Start/End: Complemental strand, 40416954 - 40416872
Alignment:
| Q |
80 |
aaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||| ||||||||||||||| |||||||| |||||| | |||||||| |
|
|
| T |
40416954 |
aaggctgtgtacaatacaccaat--tgatgggacccttttttggaccctgcatatgcgagagctttagtgcaccgggttgccctt |
40416872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 164
Target Start/End: Original strand, 22371198 - 22371246
Alignment:
| Q |
116 |
tttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
22371198 |
tttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
22371246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 164
Target Start/End: Original strand, 34080179 - 34080235
Alignment:
| Q |
108 |
tgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||| |||| |||||| | |||||||| |
|
|
| T |
34080179 |
tgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttgccctt |
34080235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 74 - 153
Target Start/End: Original strand, 44643569 - 44643646
Alignment:
| Q |
74 |
cagaataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||| ||||||||| |||||| ||||| ||| ||||| || |||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
44643569 |
cagagtaaggctgcgtacaatgtaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagccttagtgcacc |
44643646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 4e-22; HSPs: 34)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 20004176 - 20004091
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||||||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
20004176 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccctt |
20004091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 30395812 - 30395738
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
30395812 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc |
30395738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 35005197 - 35005282
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| || ||||| |||||||| |||||||| |||||| |||||| | |||||||| |
|
|
| T |
35005197 |
taaggctgcatacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttgccctt |
35005282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 18742043 - 18741969
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || |||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
18742043 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcacc |
18741969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 35253271 - 35253188
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
35253271 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt |
35253188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 47214583 - 47214666
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| ||| ||||| || ||||||||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
47214583 |
taaggttgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgcgggagctctagtgcaccagattaccctt |
47214666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 10668299 - 10668384
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| |||||||||||||||||| ||||| || ||||| | |||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
10668299 |
taaggttgcgtacaatacaccaataatggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttgccctt |
10668384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 91 - 164
Target Start/End: Original strand, 50606487 - 50606560
Alignment:
| Q |
91 |
caatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||| |||| ||||| || ||||| |||||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
50606487 |
caatacaccaaaaatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
50606560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 14617112 - 14617184
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||| ||| ||||||||||||| ||| |||||||| ||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
14617112 |
taaggttgcgtacaatacaccaa--atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcacc |
14617184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 31382299 - 31382215
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| || |||| ||||||||||||||||||||||||||| ||| | |||||||| |
|
|
| T |
31382299 |
ataaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcatatgcgggagctttactgtaccgggttgccctt |
31382215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 45812621 - 45812549
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| || |||||| |||||||||||||||||||| || |||||| |
|
|
| T |
45812621 |
taaggctgcatacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagctctagtgcacc |
45812549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 4349712 - 4349795
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
4349712 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
4349795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 145
Target Start/End: Original strand, 18944717 - 18944783
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| |||||||||||||| |
|
|
| T |
18944717 |
taaggctgcgtacaatacaccaacaatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
18944783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 32632641 - 32632558
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||||| ||||||||||||||||||||| | |||||||| || ||||| |
|
|
| T |
32632641 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccaaaccctgcatatgcgggagcttgagtgcaccaggtttccctt |
32632558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 151
Target Start/End: Original strand, 27201721 - 27201793
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgca |
151 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||| ||| ||||||||||||||| |||| |
|
|
| T |
27201721 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccttgcgtatgcgggagctttagtgca |
27201793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 1517396 - 1517312
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||| |||||||||||||| || ||||| || ||| |||||||||| ||||| ||||||||| |||||| | |||||||| |
|
|
| T |
1517396 |
ataaggctgcgtacaatacaccaat--tggtgggaccccttctcagaccctgcgtatgcaggagctttagtgcaccgggttgccctt |
1517312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 43768213 - 43768285
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || |||||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
43768213 |
taaggctgcctacaatacaccaat--tggtgggaccccttcccagaccctgcgtatacgggagctttaatgcacc |
43768285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 153
Target Start/End: Complemental strand, 45264489 - 45264411
Alignment:
| Q |
74 |
cagaataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||| |||||||| | ||||||||||| |||| ||||| || ||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
45264489 |
cagagtaaggctgtgtgcaatacaccaa-aatggtgggaccccttctcagaccctgcatatgcgggagctttagtgcacc |
45264411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 84 - 162
Target Start/End: Original strand, 45402175 - 45402251
Alignment:
| Q |
84 |
ctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccc |
162 |
Q |
| |
|
|||| ||||||||||||| ||| ||||| || |||||||||||||| ||||||||||||||| |||||| | |||||| |
|
|
| T |
45402175 |
ctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttgccc |
45402251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 19414511 - 19414594
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
19414511 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttgccctt |
19414594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 160
Target Start/End: Complemental strand, 23768404 - 23768325
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgc |
160 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| | |||||||||||||| ||||||||||||||| |||| | |||||| |
|
|
| T |
23768404 |
taaggctgcgtacaatacaccaa--atggtgggacaccttcccagaccctgcgtatgcgggagctttagtgcagcggattgc |
23768325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 34725182 - 34725099
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||| || ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
34725182 |
taaggctgcgtacaatacactaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
34725099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 164
Target Start/End: Original strand, 27474376 - 27474437
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||| || ||||| |||||||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
27474376 |
aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt |
27474437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 163
Target Start/End: Complemental strand, 19932839 - 19932755
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccct |
163 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| ||||| || | ||| |||||||| ||||||| |
|
|
| T |
19932839 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgtatgcaagatcattagtgcaccaggttgccct |
19932755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 153
Target Start/End: Original strand, 35019303 - 35019375
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||||||||||||||||||| || ||||| || ||||||||||||| |||||| |||||||| |||||| |
|
|
| T |
35019303 |
ataaggctgcatacaatacaccaat--tggtggga-cccctcccagaccctgcgtatgcgagagctttagtgcacc |
35019375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 10378819 - 10378747
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
10378819 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcacc |
10378747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 23796539 - 23796611
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||| ||| ||||||||||||| ||| || || || |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
23796539 |
taaggttgcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgctggagctttagtgcacc |
23796611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 35117852 - 35117777
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcat-atgcgggagctttactgcacc |
153 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||| || ||||| |||||||| | |||| ||||||||| |||||| |
|
|
| T |
35117852 |
taaggctgtgtacaatacaccaaaaatgatgggaccccttcccggaccctgcgtaatgcaggagctttagtgcacc |
35117777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 12126921 - 12126850
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| ||||||||||||| || ||||| || ||||| ||||||||||||||||||||| || ||||| |
|
|
| T |
12126921 |
taaggctgcgtacaatacaccaa--attgtgggaccccttcccggaccctgcatatgcgggagctgtagtgcac |
12126850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 89 - 155
Target Start/End: Original strand, 19701654 - 19701719
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccag |
155 |
Q |
| |
|
||||||||||||| |||| |||| || ||||| |||||||| ||||||||||||||| |||||||| |
|
|
| T |
19701654 |
tacaatacaccaa-aatggtggggccccttcccggaccctgcgtatgcgggagctttagtgcaccag |
19701719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 38478366 - 38478283
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||| | || ||| | ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
38478366 |
taaggctgcgtacaatacaccaa--atggtggaaccccttctcggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
38478283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 46248037 - 46247954
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| || ||| | |||||||| |
|
|
| T |
46248037 |
taagactgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttgccctt |
46247954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 162
Target Start/End: Original strand, 7074632 - 7074672
Alignment:
| Q |
122 |
agaccctgcatatgcgggagctttactgcaccagattgccc |
162 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||| ||||||| |
|
|
| T |
7074632 |
agaccctgcatatccgggagctttagtgcaccatattgccc |
7074672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 33594188 - 33594144
Alignment:
| Q |
108 |
tgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
33594188 |
tgggaccccttcccagaccctgcgtatgcgggagctttagtgcac |
33594144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 31)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 2626573 - 2626656
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||| || |||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
2626573 |
taagactgcgtacaatacaccaa--atgatgggaccccttcccagaccctgcatatgcgggagcttcagtgcaccagattgccctt |
2626656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 7136613 - 7136539
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
7136613 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcacc |
7136539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 16225070 - 16225144
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||| |||| |||||||||||||||||| |||||||| ||||| ||||| |||||||||||||||||| |||||| |
|
|
| T |
16225070 |
taagactgcgtacaatacaccaataatggtgggatcccttcccggaccccgcatatgcgggagctttagtgcacc |
16225144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 74 - 164
Target Start/End: Complemental strand, 39461085 - 39460995
Alignment:
| Q |
74 |
cagaataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| || || || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
39461085 |
cagagtaaggctgcgtacaatacaccaataatggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
39460995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 20869974 - 20870059
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || |||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
20869974 |
taaggctgcgtacaatacaccaataatggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
20870059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 152
Target Start/End: Original strand, 26954184 - 26954257
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || |||||||||| |||||||||||||||||| ||||| |
|
|
| T |
26954184 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccagacctcgcatatgcgggagctttagtgcac |
26954257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 8897848 - 8897765
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| | ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
8897848 |
taaggctacgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctttactgcacccggttgccctt |
8897765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 20284155 - 20284081
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| |||||||||| |||| |||||| |
|
|
| T |
20284155 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcacc |
20284081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 21070783 - 21070709
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| |||||||||| |||| |||||| |
|
|
| T |
21070783 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcacc |
21070709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 6760873 - 6760958
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| | |||||||||||||||||| ||||| || ||| | ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
6760873 |
taaggcttcgtacaatacaccaataatggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
6760958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 82 - 164
Target Start/End: Original strand, 25250576 - 25250658
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| || ||||| |||| ||||||||||||| |||| |||||| | |||||||| |
|
|
| T |
25250576 |
ggctgcgtacaatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagatttagtgcaccgggttgccctt |
25250658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 44781590 - 44781517
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||| || ||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
44781590 |
taaggctgtgtacaatacaccaaaaatgttgggaccccgtcccagaccctgcgtatgcgggagctttagtgcac |
44781517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 12670334 - 12670262
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| |
|
|
| T |
12670334 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
12670262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 29521769 - 29521697
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29521769 |
taaggctgcgtacaatacaccaa--atggtgggaacccatcccagaccctgcgtatgcgggagctttagtgcacc |
29521697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 12625941 - 12626024
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||| || |||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
12625941 |
taagactgcatacaatacaccaa--atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
12626024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 30454181 - 30454098
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||| ||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
30454181 |
taaggctgcgtacgatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
30454098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 36720847 - 36720930
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || ||||| |||||||| ||||||| ||||||| |||||| | |||||||| |
|
|
| T |
36720847 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcggaagctttagtgcacccggttgccctt |
36720930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 17250961 - 17250888
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
|||||| || |||||||||||||||||| ||||| |||||||| ||||||| |||| ||||||||| ||||| |
|
|
| T |
17250961 |
taaggcagcgtacaatacaccaataatggtgggaccctttcccgaaccctgcgtatgaaggagctttagtgcac |
17250888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 155
Target Start/End: Original strand, 29877145 - 29877219
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccag |
155 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||| ||| |||||||| |
|
|
| T |
29877145 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcgttagtgcaccag |
29877219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 158
Target Start/End: Original strand, 389696 - 389773
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagatt |
158 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||||| || || |||||||| |||||| |||||||| |||||| |||| |
|
|
| T |
389696 |
taaggttgcgtacaatacaccaa--atgatgggatccctttcctgaccctgcgtatgcgagagctttagtgcaccggatt |
389773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 153
Target Start/End: Original strand, 16013515 - 16013579
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||||||||| || |||| || || || |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
16013515 |
tacaatacactaaaaatggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcacc |
16013579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 166
Target Start/End: Original strand, 45071315 - 45071400
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttat |
166 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||| ||| ||||||||||||| | |||||| | |||||||||| |
|
|
| T |
45071315 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgcccttat |
45071400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 80 - 146
Target Start/End: Complemental strand, 8484021 - 8483957
Alignment:
| Q |
80 |
aaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
|||||||| |||||||||||||| || ||||| || ||||||||||||| ||||||||||||||| |
|
|
| T |
8484021 |
aaggctgcgtacaatacaccaat--tggtgggaccccatcccagaccctgcgtatgcgggagcttta |
8483957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 44530200 - 44530272
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
44530200 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcacc |
44530272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 144
Target Start/End: Original strand, 13160752 - 13160815
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctt |
144 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||| |
|
|
| T |
13160752 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctt |
13160815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 19729391 - 19729474
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||| || ||||| |||||||||||| |||||||| || ||||| |||||||||| |
|
|
| T |
19729391 |
taaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatacgggagctctagtgcactggattgccctt |
19729474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 28817710 - 28817627
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||| | ||| ||||| || ||||| |||||||| ||||||||||||||| |||| | | |||||||| |
|
|
| T |
28817710 |
taaggctgcgtacaatacaccca--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttgccctt |
28817627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 35261730 - 35261813
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| ||| ||||| || |||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
35261730 |
taaggttgcgtacaatacaccaa--atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
35261813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 88 - 164
Target Start/End: Original strand, 26102577 - 26102651
Alignment:
| Q |
88 |
atacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||||||| ||| ||||| || ||||| |||||||| |||||||||||| || |||||| | |||||||| |
|
|
| T |
26102577 |
atacaatacaccaa--atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttgccctt |
26102651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 164
Target Start/End: Original strand, 28407476 - 28407537
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||| || ||||| |||||| | |||||||||||||||||||||| | |||||||| |
|
|
| T |
28407476 |
aatggtgggaccccttcccggaccctacgtatgcgggagctttactgcaccgggttgccctt |
28407537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 80 - 164
Target Start/End: Original strand, 31457224 - 31457306
Alignment:
| Q |
80 |
aaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| ||||||||| ||| ||| | ||| || |||||| ||||||| |||||||||||| || |||||| |||||||||| |
|
|
| T |
31457224 |
aaggctgcgtacaatacatcaa--atggtaggaccccttcccaaaccctgcgtatgcgggagctctagtgcaccggattgccctt |
31457306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 51; Significance: 3e-20; HSPs: 26)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 12006414 - 12006340
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||| || |||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
12006414 |
taaggctccatacaatacaccaataatggtgggaccccttcccagaccctgcctatgcgggagctttagtgcacc |
12006340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 38879632 - 38879717
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
38879632 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
38879717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 4619190 - 4619105
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| ||||||||| |||||||| |||||| | |||||||| |
|
|
| T |
4619190 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctt |
4619105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 13801853 - 13801768
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| ||||||||| |||||||| |||||| | |||||||| |
|
|
| T |
13801853 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttgccctt |
13801768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 94 - 164
Target Start/End: Original strand, 25622524 - 25622594
Alignment:
| Q |
94 |
tacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
25622524 |
tacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgccctt |
25622594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 161
Target Start/End: Original strand, 27328803 - 27328885
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcc |
161 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||||| ||||||||||||||| |||| | ||||||| |
|
|
| T |
27328803 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccgaaccctgcgtatgcgggagctttaatgcatcggattgcc |
27328885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 20135655 - 20135740
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||| ||||||| | |||||| | |||||||| |
|
|
| T |
20135655 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttgccctt |
20135740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 32703473 - 32703556
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
32703473 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
32703556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 43334254 - 43334338
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| |||||||||||||| |||||| | |||||||| |
|
|
| T |
43334254 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgc-gatgcgggagctttagtgcaccgggttgccctt |
43334338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 42924918 - 42924831
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccag--accctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||| |||| ||||||| ||||||| ||||||| ||||||| |||||| ||||| |||| |
|
|
| T |
42924918 |
taaggttgcgtacaatacaccaaaaatgatggaatcccttcccagacaccctgcgtatgcggaagctttagtgcaccggattgtcctt |
42924831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 8170068 - 8169985
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||| || | |||||| | |||||||| |
|
|
| T |
8170068 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttgccctt |
8169985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 24448941 - 24449024
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || ||||| |||||||| ||||| ||||||||| |||||| | |||||||| |
|
|
| T |
24448941 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttgccctt |
24449024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 164
Target Start/End: Complemental strand, 31694188 - 31694109
Alignment:
| Q |
83 |
gctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||||||| || |||||||| | |||||||||| ||| |||||||||| |||| ||||||||| ||||||| |
|
|
| T |
31694188 |
gctgcatacaatacacc--tattgatgggactccttcccagaccttgcgtatgcgggagatttagtgcaccagactgccctt |
31694109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 34154898 - 34154815
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||||||||||| |||| || |||||| | |||||||| |
|
|
| T |
34154898 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttgccctt |
34154815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 41014369 - 41014452
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
41014369 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
41014452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 162
Target Start/End: Original strand, 7368447 - 7368528
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccc |
162 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || ||||| ||||||||||||| ||||||| || |||||| | |||||| |
|
|
| T |
7368447 |
taaggctgcgtacaatacaccaat--tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccc |
7368528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 164
Target Start/End: Original strand, 16957375 - 16957448
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
16957375 |
tacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
16957448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 123 - 166
Target Start/End: Original strand, 19438759 - 19438802
Alignment:
| Q |
123 |
gaccctgcatatgcgggagctttactgcaccagattgcccttat |
166 |
Q |
| |
|
||||||||||||||||||||| || |||||||| |||||||||| |
|
|
| T |
19438759 |
gaccctgcatatgcgggagctctagtgcaccaggttgcccttat |
19438802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 78 - 164
Target Start/End: Original strand, 22187335 - 22187421
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| |||| ||||||||||||| || ||| || || |||||| ||||| ||||||| ||||||||| |||| ||| |||||||| |
|
|
| T |
22187335 |
ataagactgcgtacaatacaccaaaaacaatgagaccccttcccaaaccctacatatgcaggagctttagtgcatcaggttgccctt |
22187421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 82 - 164
Target Start/End: Complemental strand, 28516515 - 28516434
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||||||||| ||| |||| ||||| || |||||||||||||| |||| ||||||||| || ||||| |||||||| |
|
|
| T |
28516515 |
ggctgcgtacaatacatcaa-aatggtgggacccattcccagaccctgcgcatgcaggagctttagtggaccaggttgccctt |
28516434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 90 - 147
Target Start/End: Complemental strand, 10306548 - 10306492
Alignment:
| Q |
90 |
acaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttac |
147 |
Q |
| |
|
|||||||||||| |||| ||||| || ||||| |||||||| |||||||||||||||| |
|
|
| T |
10306548 |
acaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttac |
10306492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 89 - 164
Target Start/End: Original strand, 1405248 - 1405321
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||| ||| ||||| ||||||| |||||||||||||||||||| || | |||| |||||||||| |
|
|
| T |
1405248 |
tacaatacaccaa--atggtgggaccctttcctgaaccctgcatatgcgggagctctagtacaccggattgccctt |
1405321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 142
Target Start/End: Original strand, 2838829 - 2838890
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagc |
142 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||||||| ||| | |||||||| ||||||||||| |
|
|
| T |
2838829 |
taaggctgcgtacaatacaccaa--atggtgggatcccttctcggaccctgcgtatgcgggagc |
2838890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 158
Target Start/End: Complemental strand, 9794462 - 9794385
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagatt |
158 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||||| ||| ||||||| |||||||| | ||||||| |||||| |||| |
|
|
| T |
9794462 |
taagactgcatacaatacacca--aatagtgggatcccttcacagacccagcatatgcagaagctttagtgcaccggatt |
9794385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 164
Target Start/End: Complemental strand, 16028681 - 16028625
Alignment:
| Q |
108 |
tgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
16028681 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
16028625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 79 - 146
Target Start/End: Original strand, 43574657 - 43574722
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||| ||||||| ||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |
|
|
| T |
43574657 |
taaggctgcgtacaatataccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttta |
43574722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 50; Significance: 1e-19; HSPs: 14)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 29355941 - 29355856
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
29355941 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
29355856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 145
Target Start/End: Complemental strand, 12222001 - 12221935
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| |||||||||||||| |
|
|
| T |
12222001 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttt |
12221935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 164
Target Start/End: Original strand, 12892071 - 12892143
Alignment:
| Q |
92 |
aatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
12892071 |
aatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
12892143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 1347013 - 1347096
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
1347013 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
1347096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 1354841 - 1354758
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
1354841 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
1354758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 2166497 - 2166411
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||| || ||||| |||||| |||| ||||||||||| |||||| | |||||||| |
|
|
| T |
2166497 |
ataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt |
2166411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 2178130 - 2178044
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||| |||||||||||||||||| ||||| || ||||| |||||| |||| ||||||||||| |||||| | |||||||| |
|
|
| T |
2178130 |
ataaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttgccctt |
2178044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 26097209 - 26097292
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| |||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
26097209 |
taaggctgcgtacaatacaccaa--atgaagggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
26097292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 84 - 164
Target Start/End: Original strand, 12885967 - 12886047
Alignment:
| Q |
84 |
ctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||||||||| || |||| ||||| || |||||||||||||| |||| |||||||||| |||||| | |||||||| |
|
|
| T |
12885967 |
ctgcgtacaatacacaaaaaatggtgggaccccttcccagaccctgcgtatgtgggagctttagtgcaccgggttgccctt |
12886047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 25557774 - 25557857
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| || | || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
25557774 |
taaggctgcgtacaatacaccaa--atgaaggaaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
25557857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 146
Target Start/End: Original strand, 32579476 - 32579541
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
|||| |||| |||||||| |||| ||| ||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
32579476 |
taagcctgcgtacaataccccaa--atggtgggaccccttcccagaccctgcatatgcgggagcttta |
32579541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 2755508 - 2755420
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatat--gcgggagctttactgcaccagattgcccttat |
166 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| | |||||| | ||||||||| |||||||||||| |||||| | |||||||||| |
|
|
| T |
2755508 |
taaggctgcgtacaatacaccaaaaatggtgggagtccttcccaaatcctgcatatgcgcgggagctttagtgcacc-ggttgcccttat |
2755420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 90 - 164
Target Start/End: Complemental strand, 3116204 - 3116130
Alignment:
| Q |
90 |
acaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||||| |||| ||||| || ||| | |||| ||| ||||||||||||||| | |||| |||||||||| |
|
|
| T |
3116204 |
acaatacaccaaaaatggtgggaccccttctcggaccttgcgtatgcgggagctttagtacaccggattgccctt |
3116130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 153
Target Start/End: Complemental strand, 14975164 - 14975102
Alignment:
| Q |
91 |
caatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||||||||||||||| ||||| || ||||| |||| ||||||||||||| |||| |||||| |
|
|
| T |
14975164 |
caatacaccaataatggtgggaccccttcccgaaccccgcatatgcgggagttttagtgcacc |
14975102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 1e-19; HSPs: 40)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 20225125 - 20225210
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
20225125 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
20225210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 23501838 - 23501923
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| |||||||||||||||||| ||||| || ||||| |||||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
23501838 |
taaggttgcgtacaatacaccaataatggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
23501923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 79 - 162
Target Start/End: Original strand, 21647015 - 21647098
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccc |
162 |
Q |
| |
|
||||||||| ||||||| |||||||||| ||||| || ||||||||||| |||||||||||||||||| |||||| | |||||| |
|
|
| T |
21647015 |
taaggctgcgtacaatataccaataatggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttgccc |
21647098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 78 - 153
Target Start/End: Original strand, 54730300 - 54730375
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||||||||| || ||||||||||||||||||| | || ||||| |||||||| ||||||||||||||| |||||| |
|
|
| T |
54730300 |
ataaggctgcgtataatacaccaataatgatggaaccccttcccggaccctgcgtatgcgggagctttagtgcacc |
54730375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 30690260 - 30690177
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| || ||||| |||||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
30690260 |
taaggctgcatacaatacaccaat--tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccaggctgccctt |
30690177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 16408687 - 16408602
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||| |||||||||||||||||| ||| | || ||||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
16408687 |
taagactgcgtacaatacaccaataatggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
16408602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 20639743 - 20639659
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
20639743 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
20639659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 167
Target Start/End: Original strand, 40915879 - 40915965
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttatt |
167 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||| | |||||| ||||||||||||| |
|
|
| T |
40915879 |
taaggctgcgtacaatacaccaa--atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgcccttatt |
40915965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 88 - 164
Target Start/End: Complemental strand, 33836564 - 33836488
Alignment:
| Q |
88 |
atacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||| | | |||||||| |
|
|
| T |
33836564 |
atacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttgccctt |
33836488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 83 - 146
Target Start/End: Original strand, 16494272 - 16494335
Alignment:
| Q |
83 |
gctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||||||||||||| ||||||| ||||||| |
|
|
| T |
16494272 |
gctgcatacaatacaccaaaaatggtgggaccctttcccagaccctgtgtatgcggaagcttta |
16494335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 79 - 146
Target Start/End: Original strand, 16911613 - 16911680
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| || |||||||||||| |
|
|
| T |
16911613 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtacgcgggagcttta |
16911680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 20225033 - 20225116
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
20225033 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
20225116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 13256485 - 13256400
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||||||| ||||| || ||||| |||| |||| ||||||||||||| |||||| | |||||||| |
|
|
| T |
13256485 |
taaggctgcgtacaatacaccaataatagtgggaccccttcccgaaccccgcatctgcgggagctttagtgcaccgggttgccctt |
13256400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 155
Target Start/End: Complemental strand, 17043478 - 17043405
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccag |
155 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
17043478 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgcatatgctggagcttta-tgcaccag |
17043405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 163
Target Start/End: Complemental strand, 29207982 - 29207900
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccct |
163 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | ||||||| |
|
|
| T |
29207982 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccct |
29207900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 170
Target Start/End: Original strand, 25629100 - 25629189
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttattact |
170 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||| || ||||| |||||| ||||||||||||||||| |||||| | |||||||| ||||| |
|
|
| T |
25629100 |
taaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttgccctttttact |
25629189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 9987918 - 9987846
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||| || |||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
9987918 |
taaggctgcatacaatacaccaa--atggtgggaccccttccttgaccttgcatatgcgggagctttaatgcacc |
9987846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 54175114 - 54175188
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccag-accctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
54175114 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttccccggaccctgcatatgcgggagctttagtgcacc |
54175188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 165
Target Start/End: Complemental strand, 8473706 - 8473620
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccag--accctgcatatgcgggagctttactgcaccagattgccctta |
165 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| || ||||| | |||||||||||||||||||||| |||||| | ||||||||| |
|
|
| T |
8473706 |
taaggctgcatacaatacacca--aatggtgggaccccttccccggacccctgcatatgcgggagctttagtgcaccgggttgccctta |
8473620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 89 - 151
Target Start/End: Original strand, 20405148 - 20405210
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgca |
151 |
Q |
| |
|
|||||||||| ||||||| ||||| || ||||| ||||| |||||||||||||||||| |||| |
|
|
| T |
20405148 |
tacaatacactaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
20405210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 83 - 153
Target Start/End: Complemental strand, 30352662 - 30352592
Alignment:
| Q |
83 |
gctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||| ||||||||||||| |||| ||||| || ||| | |||||||| ||||||||||||||| |||||| |
|
|
| T |
30352662 |
gctgcgtacaatacaccaaaaatggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcacc |
30352592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 152
Target Start/End: Original strand, 30639430 - 30639501
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| ||||||||||||| ||| || || || ||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
30639430 |
taaggctgcgtacaatacaccaa--atggtgagaccccttcccggaccctgcatatgcgggagctttagtgcac |
30639501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 82 - 164
Target Start/End: Complemental strand, 44363213 - 44363131
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||||| |||||| |||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
44363213 |
ggctgcgtacaacgcaccaaaaatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
44363131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 51865122 - 51865039
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||| || ||||| |||||||| ||||||||||||||| |||||| || ||||||| |
|
|
| T |
51865122 |
taaggctgcgtacaatacaccaa--atggtggggccccttcccggaccctgcgtatgcgggagctttattgcaccggactgccctt |
51865039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 20908721 - 20908649
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| ||||||| ||||||||||||||| ||||| |
|
|
| T |
20908721 |
taaggctgcgtacaatacaccaa-aatggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcac |
20908649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 89 - 146
Target Start/End: Complemental strand, 49938668 - 49938612
Alignment:
| Q |
89 |
tacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||||||| |||| ||||| || |||||| ||||||||||||||||||||||| |
|
|
| T |
49938668 |
tacaatacaccaa-aatggtgggaccccttcccataccctgcatatgcgggagcttta |
49938612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 166
Target Start/End: Complemental strand, 6430710 - 6430625
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttat |
166 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| | ||||| |||||||| ||||||||||||||| ||||| | |||||||||| |
|
|
| T |
6430710 |
taaggctgcgtacaatacaccaa--atggtgggaccacttcccggaccctgcgtatgcgggagctttagcgcaccgggttgcccttat |
6430625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 146
Target Start/End: Original strand, 10660458 - 10660521
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||||||||||||||||||| || || || |||| ||| ||||| ||||||||||||||| |
|
|
| T |
10660458 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta |
10660521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 82 - 146
Target Start/End: Original strand, 10874603 - 10874666
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||||||||||||||||||| || || || |||| ||| ||||| ||||||||||||||| |
|
|
| T |
10874603 |
ggctgcatacaatacaccaataatggtgagaccccttccaaga-cctgcgtatgcgggagcttta |
10874666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 108 - 164
Target Start/End: Original strand, 32484311 - 32484367
Alignment:
| Q |
108 |
tgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| || ||||| |||||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
32484311 |
tgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttgccctt |
32484367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 164
Target Start/End: Complemental strand, 38755973 - 38755909
Alignment:
| Q |
100 |
aataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
38755973 |
aataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
38755909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 78 - 164
Target Start/End: Complemental strand, 10277842 - 10277758
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||||| ||||||||||||| ||| || | || ||||||||||||||||||||||||| | || || ||| |||||||||| |
|
|
| T |
10277842 |
ataaggctgcgtacaatacaccaa--atggtgaaaccccttcccagaccctgcatatgcgggagttctagtgaaccggattgccctt |
10277758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 2813176 - 2813262
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt-actgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||| ||||||||| |||||||| ||||| |||||||| || ||| |||||||||||||| | |||||| |||||||||| |
|
|
| T |
2813176 |
taagactgcgtacaatacatcaataatggtgggaccctttcccgaacgatgcgtatgcgggagctttaagtgcaccggattgccctt |
2813262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 144
Target Start/End: Original strand, 5648309 - 5648372
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctt |
144 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||| |
|
|
| T |
5648309 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctt |
5648372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 9832397 - 9832314
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||||||||| ||| || || |||||| | |||||||| |
|
|
| T |
9832397 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggaactctagtgcaccgggttgccctt |
9832314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 144
Target Start/End: Original strand, 47444008 - 47444071
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctt |
144 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||||||||| ||||||| |
|
|
| T |
47444008 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcaggagctt |
47444071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 47528614 - 47528531
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || ||||| ||||||| ||||| ||||||| || |||||| | |||||||| |
|
|
| T |
47528614 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccctgaatatgtgggagctctagtgcaccgggttgccctt |
47528531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 48598909 - 48598826
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || ||||| |||| ||||||||| |||||| || |||||| | |||||||| |
|
|
| T |
48598909 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccggaccatgcatatgccggagctctagtgcaccgggttgccctt |
48598826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 164
Target Start/End: Original strand, 38786682 - 38786743
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
38786682 |
aatggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
38786743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 164
Target Start/End: Original strand, 8820578 - 8820642
Alignment:
| Q |
100 |
aataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||| ||||| || |||||||||||||| |||||| ||| |||| |||| ||||||| |||| |
|
|
| T |
8820578 |
aataatggtgggaccccttcccagaccctgcgtatgcgagagttttagtgcatcagattgtcctt |
8820642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 33)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 13628876 - 13628791
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
13628876 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
13628791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 79 - 163
Target Start/End: Complemental strand, 353435 - 353351
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccct |
163 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| | ||||||| |
|
|
| T |
353435 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccct |
353351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 79 - 153
Target Start/End: Original strand, 14987030 - 14987104
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||| ||||||||||||||||||| |||||| |
|
|
| T |
14987030 |
taaggctgcgtacaatacaccaataatggtgggacccattcccggaccttgcatatgcgggagctttagtgcacc |
14987104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 13730688 - 13730603
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
13730688 |
taaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
13730603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 49013559 - 49013474
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| ||||| |||||||||||| |||||| | |||||||| |
|
|
| T |
49013559 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttgccctt |
49013474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 79 - 146
Target Start/End: Original strand, 9607276 - 9607343
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||| || ||||||||||||||| ||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
9607276 |
taaggctgcgtagaatacaccaataatgttgggaccccttcccagaccccgcatatgcgggagcttta |
9607343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 79 - 146
Target Start/End: Complemental strand, 46421121 - 46421054
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| ||||||||||||||| |
|
|
| T |
46421121 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgcgggagcttta |
46421054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 10795509 - 10795424
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || |||| |||||||| ||||||||||||| | |||||||| |||||||| |
|
|
| T |
10795509 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgccctt |
10795424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 103 - 164
Target Start/End: Original strand, 24577930 - 24577991
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||| || |||||| |||||||||| |
|
|
| T |
24577930 |
aatggtgggatcctttcccagaccctgcatatacgggagctctagtgcaccggattgccctt |
24577991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 29366806 - 29366733
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| |||||||| |||| |||||||||| ||||| |
|
|
| T |
29366806 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcac |
29366733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 6411906 - 6411834
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| || |||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
6411906 |
taaggctgcgtacaatacaccaa--atgatgggaccccttcccagaccttgcgtatgcgggagctttagtgcacc |
6411834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 40272896 - 40272813
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
40272896 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
40272813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 54484764 - 54484847
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
54484764 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
54484847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 167
Target Start/End: Complemental strand, 22123001 - 22122915
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttatt |
167 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||| ||||| || |||||| | ||||||||||| |
|
|
| T |
22123001 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttgcccttatt |
22122915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 45786300 - 45786215
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| |||||||| |||| ||||||||| |||||| | |||||||| |
|
|
| T |
45786300 |
taaggctgcgtacaatacaccaaaaatggtgggaccccttcccggaccctgcgaatgctggagctttagtgcaccgggttgccctt |
45786215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 155
Target Start/End: Complemental strand, 54374430 - 54374355
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccag |
155 |
Q |
| |
|
||||||||| |||||| |||||| |||| ||||| || ||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
54374430 |
taaggctgcgtacaatccaccaa-aatggtgggaccccttcccggaccctgcatatgcgggagctttagttcaccag |
54374355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 146
Target Start/End: Complemental strand, 8247773 - 8247706
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||| ||| |||||||||||||||||| ||||| | ||||| |||||||| ||||||||||||||| |
|
|
| T |
8247773 |
taaggttgcgtacaatacaccaataatggtgggactccttcccggaccctgcgtatgcgggagcttta |
8247706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 34771448 - 34771376
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| |
|
|
| T |
34771448 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcacc |
34771376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 45948922 - 45948850
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||||||||||||||||||||||| || ||||| || ||| | |||||||| ||||||||||||||| |||||| |
|
|
| T |
45948922 |
taaggctgcatacaatacaccaat--tggtgggaccccttctcggaccctgcgtatgcgggagctttagtgcacc |
45948850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 1217161 - 1217244
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
1217161 |
taaggctgcgtacaatacaccaa--atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
1217244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 12914119 - 12914036
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| || ||||||||||||| ||| || || || |||||||||||||||||||||||||||| | |||||| | |||||||| |
|
|
| T |
12914119 |
taaggcggcgtacaatacaccaa--atggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttgccctt |
12914036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 15797293 - 15797376
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||| ||||||| || |||||| | |||||||| |
|
|
| T |
15797293 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttgccctt |
15797376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 31592920 - 31593003
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| | ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
31592920 |
taaggctgcgtacaatacaccaa--atggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
31593003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 39203587 - 39203670
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| ||| ||||| || ||||| |||| ||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
39203587 |
taaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttgccctt |
39203670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 145
Target Start/End: Complemental strand, 45139562 - 45139497
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| || |||||||| ||||| ||||||||| |||| |
|
|
| T |
45139562 |
taaggctgcatacaatacaccaaaaatggtgggaccccttcccaga-cctgcgtatgcgggaacttt |
45139497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 5173805 - 5173720
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||||| ||||||||||| |||| |||| || ||||| |||| ||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
5173805 |
taaggttgcatgcaatacaccaaaaatggtggggccccttcccggaccttgcgtatgcgggagctttagtgcaccgggttgccctt |
5173720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 165
Target Start/End: Original strand, 22609838 - 22609922
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctta |
165 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||| ||| ||||||||||||| | |||||| | ||||||||| |
|
|
| T |
22609838 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctta |
22609922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 52926303 - 52926220
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| | ||||| |||||||| ||||||||||||||| ||||| | |||||||| |
|
|
| T |
52926303 |
taaggctgcgtacaatacaccaa--atggtgggacaccttcccggaccctgcgtatgcgggagctttagcgcaccgggttgccctt |
52926220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 153
Target Start/End: Complemental strand, 53996650 - 53996577
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||| || ||||| ||| |||| |||| |||||||||| |||||| |
|
|
| T |
53996650 |
taaggctgcttacaatacaccaa-aatggtgggaccccttccctgacactgcgtatgtgggagctttagtgcacc |
53996577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 164
Target Start/End: Complemental strand, 24851363 - 24851302
Alignment:
| Q |
103 |
aatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| ||||| || ||||| || ||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
24851363 |
aatggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttgccctt |
24851302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 155
Target Start/End: Original strand, 26573200 - 26573274
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccag |
155 |
Q |
| |
|
||||||||| |||||||||||||| || ||||| || |||| |||||||| |||||| |||||||| |||||||| |
|
|
| T |
26573200 |
taaggctgcgtacaatacaccaat--tggtgggaccccatcccggaccctgcgtatgcgtgagctttagtgcaccag |
26573274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 108 - 164
Target Start/End: Original strand, 30452895 - 30452951
Alignment:
| Q |
108 |
tgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
30452895 |
tgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
30452951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 164
Target Start/End: Original strand, 47624207 - 47624255
Alignment:
| Q |
116 |
tttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
47624207 |
tttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
47624255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 3e-17; HSPs: 23)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 42805575 - 42805660
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||||||||||||| |||||| | |||||||| |
|
|
| T |
42805575 |
taaggctgtgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttgccctt |
42805660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 47716510 - 47716595
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| ||||||||||||||||| |||||| | |||||||| |
|
|
| T |
47716510 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttgccctt |
47716595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 21172093 - 21172010
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
21172093 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
21172010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 42391184 - 42391101
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
42391184 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
42391101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 42798720 - 42798803
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| |||||||| ||||||||||||||||||||| || |||| | | |||||||| |
|
|
| T |
42798720 |
taaggctgcgtacaatacaccaa--atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttgccctt |
42798803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 48735206 - 48735123
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
48735206 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
48735123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 78 - 161
Target Start/End: Complemental strand, 33871995 - 33871914
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcc |
161 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| || ||||||||||||| |||||| |||||||| |||||||| ||||| |
|
|
| T |
33871995 |
ataaggctgcgtacaatacaccaa--atggtgggaccccttcccagaccctgtgtatgcgagagctttagtgcaccaggttgcc |
33871914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 85 - 164
Target Start/End: Complemental strand, 38262274 - 38262197
Alignment:
| Q |
85 |
tgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||||||| ||||||||| || ||||| || |||| ||||||||||||||| |||||| |||||||||| |
|
|
| T |
38262274 |
tgcatacaatacaccaa--atgatgggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgccctt |
38262197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 74 - 145
Target Start/End: Original strand, 43557518 - 43557589
Alignment:
| Q |
74 |
cagaataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| ||||| || |||| ||| |||| |||||||||||||| |
|
|
| T |
43557518 |
cagagtaaggctgcgtacaatacaccaataatggtgggaccccctcccggactctgcgtatgcgggagcttt |
43557589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 7879689 - 7879772
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||| | |||||| | |||||||| |
|
|
| T |
7879689 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgccctt |
7879772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 152
Target Start/End: Complemental strand, 10693157 - 10693086
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcac |
152 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || ||||| |
|
|
| T |
10693157 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcac |
10693086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 32758310 - 32758393
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
32758310 |
taaggctgtgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
32758393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 42476922 - 42477005
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || |||| || | ||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
42476922 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcctaggctctgcatatgcgggagctctagtgcaccaggttgccctt |
42477005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 79 - 136
Target Start/End: Original strand, 46354245 - 46354302
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgc |
136 |
Q |
| |
|
||||||||| |||||||||||||||||| ||||| || ||||| ||||| |||||||| |
|
|
| T |
46354245 |
taaggctgcgtacaatacaccaataatggtgggaccccttcccggaccccgcatatgc |
46354302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 166
Target Start/End: Original strand, 11741844 - 11741929
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcccttat |
166 |
Q |
| |
|
||||||||| ||||||||||||| ||| |||||||| ||||| || ||||| ||||||||||| || |||||| | |||||||||| |
|
|
| T |
11741844 |
taaggctgcgtacaatacaccaa--atggtgggatcccttcccggattctgcacatgcgggagctctagtgcaccgggttgcccttat |
11741929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 146
Target Start/End: Complemental strand, 34626292 - 34626227
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttta |
146 |
Q |
| |
|
||||||||| | ||||||||||| ||| |||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
34626292 |
taaggctgcgttcaatacaccaa--atggtgggatcccttcccggaccctgcgtatgcgggagcttta |
34626227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 79 - 145
Target Start/End: Complemental strand, 28362229 - 28362165
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||| || |||||||||| |||||||| ||||||||| |
|
|
| T |
28362229 |
taaggctgcgtacaatacacca--aatggtgggaccccttcccagaccttgcatatgtgggagcttt |
28362165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 117 - 164
Target Start/End: Complemental strand, 45018971 - 45018924
Alignment:
| Q |
117 |
ttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| |||||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
45018971 |
ttcccggaccctgcgtatgcgggagctttagtgcaccaggttgccctt |
45018924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 144
Target Start/End: Original strand, 19266501 - 19266564
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctt |
144 |
Q |
| |
|
||||||||| ||||||||||||| || |||||||| ||||| |||||||| ||||||||||||| |
|
|
| T |
19266501 |
taaggctgcgtacaatacaccaa--attgtgggatcccttcccggaccctgcgtatgcgggagctt |
19266564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 80 - 145
Target Start/End: Complemental strand, 27889399 - 27889336
Alignment:
| Q |
80 |
aaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagcttt |
145 |
Q |
| |
|
|||||||| ||||||||||||| ||| ||||| || ||||| |||||||| |||||||||||||| |
|
|
| T |
27889399 |
aaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagcttt |
27889336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 118 - 164
Target Start/End: Original strand, 36602535 - 36602581
Alignment:
| Q |
118 |
tcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
36602535 |
tcccagaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
36602581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 79 - 143
Target Start/End: Complemental strand, 2663019 - 2662958
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagct |
143 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
2663019 |
taaggctgcgtacaatacaccaa--atggtgggacccttttc-agaccctgcatatgcgggagct |
2662958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 84 - 153
Target Start/End: Original strand, 21566491 - 21566559
Alignment:
| Q |
84 |
ctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcacc |
153 |
Q |
| |
|
|||| ||||||||||||| |||| | ||| || ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21566491 |
ctgcgtacaatacaccaa-aatggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcacc |
21566559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1176 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold1176
Description:
Target: scaffold1176; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 161
Target Start/End: Complemental strand, 1672 - 1591
Alignment:
| Q |
78 |
ataaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgcc |
161 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||||| ||||| || ||||||||||||||| |||||||| ||||| |
|
|
| T |
1672 |
ataaggctgcatacaatacaccaa--atgatgggaccccttcccggacccggcgtatgcgggagctttagtgcaccaggttgcc |
1591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 24217 - 24134
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| |||||||||| |
|
|
| T |
24217 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggattgccctt |
24134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0223 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0223
Description:
Target: scaffold0223; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 11180 - 11263
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| | ||||| ||||||||||||||||||||| || |||||||| |||||||| |
|
|
| T |
11180 |
taaggctgcttacaatacaccaa--atggtgggacaccttcccggaccctgcatatgcgggagctctagtgcaccaggttgccctt |
11263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 48718 - 48635
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
48718 |
taaggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
48635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 59028 - 59113
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||| |||| ||||||||||||| |||| ||||| || ||||||||| |||| ||||||||||||||| |||| | | |||||||| |
|
|
| T |
59028 |
taagactgcgtacaatacaccaaaaatggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttgccctt |
59113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 37; Significance: 0.000000000006; HSPs: 2)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 79 - 151
Target Start/End: Complemental strand, 46792 - 46721
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgca |
151 |
Q |
| |
|
||||| ||||||||||| ||||| |||| ||||| || |||||||||||||| ||||||||||||||| |||| |
|
|
| T |
46792 |
taaggatgcatacaatataccaa-aatggtgggaccccttcccagaccctgcgtatgcgggagctttaatgca |
46721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Original strand, 46882 - 46965
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||| ||| ||||||||||||| ||| ||||| || ||||| |||||||| ||||||||||||||| |||||| | |||||||| |
|
|
| T |
46882 |
taaggttgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctt |
46965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 82 - 164
Target Start/End: Original strand, 30631 - 30711
Alignment:
| Q |
82 |
ggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||| || ||||| ||||||||||||||||||||| || |||||| | |||||||| |
|
|
| T |
30631 |
ggctgcgtacaatacaccaa--atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttgccctt |
30711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 13108 - 13025
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||| | ||| ||||| || |||||||||||||| |||||||| |||||| |||||| | |||||||| |
|
|
| T |
13108 |
taaggctgcgtacaatacaccga--atggtgggaccccttcccagaccctgcgtatgcgggggctttagtgcaccgggttgccctt |
13025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 164
Target Start/End: Complemental strand, 72951 - 72868
Alignment:
| Q |
79 |
taaggctgcatacaatacaccaataatgatgggatcctttcccagaccctgcatatgcgggagctttactgcaccagattgccctt |
164 |
Q |
| |
|
||||||||| ||||||||||||| ||| | | | || ||||| || ||||| ||||||||||||||| |||||||| |||||||| |
|
|
| T |
72951 |
taaggctgcctacaatacaccaa--atggtagtaccccttcccggaacctgcgtatgcgggagctttagtgcaccaggttgccctt |
72868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University