View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_43 (Length: 266)
Name: NF4458_low_43
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 54096954 - 54096800
Alignment:
| Q |
1 |
ttcacccttggacttggctcctttcatgatgaaaactgaagttcaagaatcgcgttagtttttacagcgaaaagtgatagaaaatcgaagaaaattgagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54096954 |
ttcacccttggacttggctcctttcatgatgaaaactgcagttaaagaatcgcgttagtttttacagcgaaaagtgatagaaaatcgaagaaaattgagc |
54096855 |
T |
|
| Q |
101 |
gaaattgatagaagaaacgtaccgaaaggtggaatggggttggaaactagggttt |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54096854 |
gaaattgatagaagaaacgtaccgaaaggtggaatggggttggaaactagggttt |
54096800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 191 - 248
Target Start/End: Complemental strand, 54096756 - 54096699
Alignment:
| Q |
191 |
ttgtggaatgcgctagttgtatacgagagacactagggtaaggatcaaatgcgggtag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54096756 |
ttgtggaatgcgctagttgtatacgagagacactagggtaaggatcaaatgcgggtag |
54096699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University