View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_45 (Length: 255)
Name: NF4458_low_45
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 237
Target Start/End: Complemental strand, 14923708 - 14923485
Alignment:
| Q |
11 |
cagagaaaggaatcaaagtcgaaatgcattagaaagaaagtttaaacgaagaagcgagaaacggaaaaagcggttacaggctcgaggaagatgttgccgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14923708 |
cagagaaaggaatcaaagtcgaaatgcattagaaagaaagtttaaacgaagaagcgagaaacggaaaaagcggttacaggctcgaggaagatgttgccgt |
14923609 |
T |
|
| Q |
111 |
gaacgttatcacggatatgcttgaggaatttccgttcgagagagacggaatcgttcaatgaagcatggatcgccatggaagaatcggtgatcatcatcga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
14923608 |
gaacgttatcacggatatgcttgaggaatttccgttcgagagagacggaatcgttcaatgaagcagggatcgccatggaagaatcggtgat---catcga |
14923512 |
T |
|
| Q |
211 |
gtgaagtggaagaatgcagtgaaatct |
237 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
14923511 |
gtgaagtggaagaatgcagtgaaatct |
14923485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University