View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4458_low_52 (Length: 236)
Name: NF4458_low_52
Description: NF4458
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4458_low_52 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 236
Target Start/End: Complemental strand, 54097166 - 54096937
Alignment:
| Q |
7 |
atcatcaaaatcaacaatattaataagcataacacaaaaatcgtttaccgaaagagaaattatgctagnnnnnnncgattatcagatctcagatctggaa |
106 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54097166 |
atcatcaaaatcaacaatatcaataagcataacacaaaaatcgtttaccgaaagagaaattatgctagtttttttcgattatcagatctcagatctggaa |
54097067 |
T |
 |
| Q |
107 |
aacacgaaaccctaatttactcgnnnnnnnatgaaatcgaaagcgatttaaacgatttaagatgaaattatgaaaaaacgaattgaacttacttagcatc |
206 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54097066 |
aacacgaaaccctaatttactcgtttttttatgaaatcgaaagcgatttaaacgatttaagatgaaattatgaaaaaacgaattgaacttacttagcatc |
54096967 |
T |
 |
| Q |
207 |
ggctttcttcgattcacccttggacttggc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
54096966 |
ggctttcttcgattcacccttggacttggc |
54096937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University