View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4459-Insertion-10 (Length: 145)
Name: NF4459-Insertion-10
Description: NF4459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4459-Insertion-10 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 104; Significance: 3e-52; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 104; E-Value: 3e-52
Query Start/End: Original strand, 10 - 145
Target Start/End: Original strand, 38835192 - 38835330
Alignment:
| Q |
10 |
tatattacattaggtatagagttttgagaacaattatatgtttt--gattgttatggttttttatgt-gtgcctcttaggattcgtccctatttgggtgt |
106 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| | | |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
38835192 |
tatattacattaggtatagagttgtgagaacaatttttttttttttgattgttatggttttttatgttgtgcctcttaggattcgtccctatttgggtgt |
38835291 |
T |
|
| Q |
107 |
gttttcccatagtgagcgatgagttgctgaattggttca |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38835292 |
gttttcccatagtgagcgatgagttgctgaattggttca |
38835330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University