View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4459-Insertion-12 (Length: 130)
Name: NF4459-Insertion-12
Description: NF4459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4459-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 26496359 - 26496237
Alignment:
| Q |
8 |
ataagttcaattatgtttatccaaataggcccttaatctcttattattaactaatgaagccattattcattgtgtttacaaatgatattgtttgttcagg |
107 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26496359 |
ataagttcaattaagtttatccaaataggccctgaatctcttattattaactaatgaagccattattcattgtgtttacaaatgatattgtttgttcagg |
26496260 |
T |
|
| Q |
108 |
taggaacttttgcaagtctggta |
130 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26496259 |
taggaacttttgcaagtctggta |
26496237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University