View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4459-Insertion-12 (Length: 130)

Name: NF4459-Insertion-12
Description: NF4459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4459-Insertion-12
NF4459-Insertion-12
[»] chr8 (1 HSPs)
chr8 (8-130)||(26496237-26496359)


Alignment Details
Target: chr8 (Bit Score: 115; Significance: 8e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 115; E-Value: 8e-59
Query Start/End: Original strand, 8 - 130
Target Start/End: Complemental strand, 26496359 - 26496237
Alignment:
8 ataagttcaattatgtttatccaaataggcccttaatctcttattattaactaatgaagccattattcattgtgtttacaaatgatattgtttgttcagg 107  Q
    ||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26496359 ataagttcaattaagtttatccaaataggccctgaatctcttattattaactaatgaagccattattcattgtgtttacaaatgatattgtttgttcagg 26496260  T
108 taggaacttttgcaagtctggta 130  Q
    |||||||||||||||||||||||    
26496259 taggaacttttgcaagtctggta 26496237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University