View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4459_low_7 (Length: 241)
Name: NF4459_low_7
Description: NF4459
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4459_low_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 196
Target Start/End: Complemental strand, 26831623 - 26831446
Alignment:
| Q |
19 |
ctaatctcatcgcatggctaaaacagtttcatccattttccttctaaattgtgattatagtcatagttatggttacgtacactgcaagctttgatactac |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26831623 |
ctaatctcatcgcatggctaaaacagtttcatccattttccttctgaattgtgattatagtcatagttatggttacatacgctgcaagctttgatactac |
26831524 |
T |
 |
| Q |
119 |
aataatacaaacaaatgtggctgatatgcggccacaattatagctgtgatgtcgttgtagaaaccattaattaagatg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26831523 |
gataatacaaacaaatgtggctgatatgcggccacaattatagctgtgatgtcattgtagaaaccattaattacgatg |
26831446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University