View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4460_low_3 (Length: 249)
Name: NF4460_low_3
Description: NF4460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4460_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 10562146 - 10561903
Alignment:
| Q |
1 |
acttacttcacttcactttgtttcaaaactcttttgagatcgcgtttttcttttggatttgggtgagtgttttcactctaaatttcactttcaaatcaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| |
|
|
| T |
10562146 |
acttacttcacttcactttgtttcagaactcttttgagatcgcgtttttcttttggatttgggtgagtgttttcactctaaactcccctttcaaatcaaa |
10562047 |
T |
|
| Q |
101 |
gaaaatataattttcaattgtatcttatactcttacagacagggcgggacttggctcaatggtaaggttgttgccgtgtcacatgttcgaattctaaaac |
200 |
Q |
| |
|
| |||||||| ||||||||||||||| |||||||||||| ||| || |||||||| |||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
10562046 |
ggaaatataactttcaattgtatcttctactcttacagagaggacgagacttggcgcaatggtaagattgttgccgtgtcacatgttcgaattctaaatc |
10561947 |
T |
|
| Q |
201 |
agcctctccgcgtgtggtggtaaggctgtgtacatctgtgctgc |
244 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10561946 |
agcctctccacgtgtggtggtaaggctgtgtacatctgtcctgc |
10561903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 21 - 78
Target Start/End: Original strand, 24125407 - 24125464
Alignment:
| Q |
21 |
tttcaaaactcttttgagatcgcgtttttcttttggatttgggtgagtgttttcactc |
78 |
Q |
| |
|
||||||||| ||||||||| |||||||||| || ||||||||| |||||||||||| |
|
|
| T |
24125407 |
tttcaaaacacttttgagagtacgtttttcttctgaatttgggtgtgtgttttcactc |
24125464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University