View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4460_low_5 (Length: 214)

Name: NF4460_low_5
Description: NF4460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4460_low_5
NF4460_low_5
[»] chr3 (1 HSPs)
chr3 (23-112)||(41676069-41676158)


Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 23 - 112
Target Start/End: Original strand, 41676069 - 41676158
Alignment:
23 tagccctatcaatgtattttgctttggaggcgcgcaagaagttggttttttccatgagtatagagaaggtgttgattgggtgagtacttc 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41676069 tagccctatcaatgtattttgctttggaggcgcgcaagaagttggttttttccatgagtatagagaaggtgttgattgggtgagtacttc 41676158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University