View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4460_low_5 (Length: 214)
Name: NF4460_low_5
Description: NF4460
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4460_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 23 - 112
Target Start/End: Original strand, 41676069 - 41676158
Alignment:
| Q |
23 |
tagccctatcaatgtattttgctttggaggcgcgcaagaagttggttttttccatgagtatagagaaggtgttgattgggtgagtacttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41676069 |
tagccctatcaatgtattttgctttggaggcgcgcaagaagttggttttttccatgagtatagagaaggtgttgattgggtgagtacttc |
41676158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University