View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4461_high_11 (Length: 226)
Name: NF4461_high_11
Description: NF4461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4461_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 133 - 206
Target Start/End: Complemental strand, 871182 - 871109
Alignment:
| Q |
133 |
caagcattttattttttgtaaaaattaagaattctggatttttattaaaacacgtttggaacacaattaagttt |
206 |
Q |
| |
|
||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
871182 |
caagcgtttaattttttgtagaaattaagaattctggatttttattaaaacacgtttggaacacaataaagttt |
871109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 131
Target Start/End: Complemental strand, 871185 - 871141
Alignment:
| Q |
87 |
ggacaagcgttttattttatgtagaaattcagaattctggatttt |
131 |
Q |
| |
|
|||||||||||| ||||| |||||||||| ||||||||||||||| |
|
|
| T |
871185 |
ggacaagcgtttaattttttgtagaaattaagaattctggatttt |
871141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University