View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4461_high_11 (Length: 226)

Name: NF4461_high_11
Description: NF4461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4461_high_11
NF4461_high_11
[»] chr4 (2 HSPs)
chr4 (133-206)||(871109-871182)
chr4 (87-131)||(871141-871185)


Alignment Details
Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 133 - 206
Target Start/End: Complemental strand, 871182 - 871109
Alignment:
133 caagcattttattttttgtaaaaattaagaattctggatttttattaaaacacgtttggaacacaattaagttt 206  Q
    ||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
871182 caagcgtttaattttttgtagaaattaagaattctggatttttattaaaacacgtttggaacacaataaagttt 871109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 87 - 131
Target Start/End: Complemental strand, 871185 - 871141
Alignment:
87 ggacaagcgttttattttatgtagaaattcagaattctggatttt 131  Q
    |||||||||||| ||||| |||||||||| |||||||||||||||    
871185 ggacaagcgtttaattttttgtagaaattaagaattctggatttt 871141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University