View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4461_high_5 (Length: 385)
Name: NF4461_high_5
Description: NF4461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4461_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 362; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 362; E-Value: 0
Query Start/End: Original strand, 1 - 366
Target Start/End: Complemental strand, 50264067 - 50263702
Alignment:
| Q |
1 |
ttatatcaaaatgagagtagtgaatttgaatggtggactacaaaatgcaacttttctaatgtcttcttaggaggtgatagtgcaggtggtaacatagctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50264067 |
ttatatcaaaatgagagtagtgaatttgaatggtggactaaaaaatgcaacttttctaatgtcttcttaggaggtgatagtgcaggtggtaacatagctt |
50263968 |
T |
 |
| Q |
101 |
ataatgttgccaaaagggtaggttcatgtgaaggtgcatttttaaggcctttaaatttaaagggtcttattttggtacaaccattttttggtggaaaaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50263967 |
ataatgttgccaaaagggtaggttcatgtgaaggtgcatttttaaggcctttaaatttaaagggtcttattttggtacaaccattttttggtggaaaaga |
50263868 |
T |
 |
| Q |
201 |
aagaacattatcagagaaatgcatggaacaattatctggttctgctttgaatttagcagcttcagatacttattggcgattggcattaccatatggcgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50263867 |
aagaacattatcagagaaatgcatggaacaattatctggttctgctttgaatttagcagcttcagatacttattggcgattggcattaccatatggcgaa |
50263768 |
T |
 |
| Q |
301 |
gatcgcgatcatccatggtgtaatccattggtgaaaatggaggaattgaagctactgatgatgcct |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50263767 |
gatcgcgatcatccatggtgtaatccattggtgaaaatggaggaattgaagctactgatgatgcct |
50263702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University