View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4461_low_12 (Length: 238)
Name: NF4461_low_12
Description: NF4461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4461_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 238
Target Start/End: Complemental strand, 50264341 - 50264110
Alignment:
| Q |
7 |
ggacatcatcattgacagtgttacaaacatttgggcacgtttctatgttccaaattcttcacnnnnnnnnctacctttgttagtgtattttcatggtggt |
106 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
50264341 |
ggacattatcattgacagtgttacaaacatttgggcacgtttctatgttccaaattctccacaaaaaaaactacctttgttagtgtattttcatggtggt |
50264242 |
T |
|
| Q |
107 |
ggtttctgtgttggttctgcagcttggagttgctaccatgaatttcttgctatgctatcttcaaaagttggttgcttgattatgtcagttaactataggt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50264241 |
ggtttctgtgttggttctgcagcttggagttgctaccatgaatttcttgctatgctatctttaaaagttggttgcttgattatgtcagttaactataggt |
50264142 |
T |
|
| Q |
207 |
tagcaccagaaaatcctcttccagcaccttat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50264141 |
tagcaccagaaaatcctcttccagcaccttat |
50264110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University