View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4461_low_8 (Length: 311)
Name: NF4461_low_8
Description: NF4461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4461_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 15 - 180
Target Start/End: Complemental strand, 49202431 - 49202266
Alignment:
| Q |
15 |
agatgtaatgtcatcttctgtagttccaaaggggacaacagtgcttataataagaaacttgtctttgcaatgcatatcaggcggtgccgtgcgttgagct |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
49202431 |
agatgtaatgtcatcttctgtagttccaaaggggacaacagtgcttataataagaaacttgtctttgcaatgcatatcagggggtgccgtgcgttgagct |
49202332 |
T |
|
| Q |
115 |
tgcatcgtaactagtacatccaaaaaataaacataagccagtaacttgtgttacttgaatcatact |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
49202331 |
tgcatcgtaactagtacatccaaaaaataaacataagccaataacttgtgttacttgaatcatact |
49202266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 224 - 298
Target Start/End: Complemental strand, 49202224 - 49202150
Alignment:
| Q |
224 |
tgaattgagccttaaacaagaaggtaaatgnnnnnnntaccagtgaaatcacatttatcctttggcttgatgatg |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49202224 |
tgaattgagccttaaacaagaaggtaaatgaaaaaaataccagtgaaatcacatttatcctttggcttgatgatg |
49202150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University