View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462-Insertion-8 (Length: 123)
Name: NF4462-Insertion-8
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462-Insertion-8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 52724848 - 52724744
Alignment:
| Q |
8 |
tttaccagatgaaacgaattgacgaatattggaatgaaaggaagggaagattgagaggtctatcacggtttcgagcttgggctcagagaaggtggtgatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
52724848 |
tttaccagatgaaacgaattgacgaatattggaatgaaaggaagggaagattgagaggtctatgacggtttcgagcttgggctcagagaaggtggtgatg |
52724749 |
T |
|
| Q |
108 |
atggt |
112 |
Q |
| |
|
|||| |
|
|
| T |
52724748 |
gtggt |
52724744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University