View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462-Insertion-9 (Length: 120)
Name: NF4462-Insertion-9
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462-Insertion-9 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 1e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 1e-57
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 31771425 - 31771313
Alignment:
| Q |
8 |
gtcgcttacttgtgcaacttgattattatcataatcttcatcagaggatgaagaagaattaccagaaccatctctatcaccgtgatcaaccttaaagaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31771425 |
gtcgcttacttgtgcaacttgattattatcataatcttcatcagaggatgaagaagaattaccagaaccatctctatcaccgtgatcaaccttaaagaat |
31771326 |
T |
 |
| Q |
108 |
ctcctcttaatca |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
31771325 |
ctcctcttaatca |
31771313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University