View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462_low_10 (Length: 338)
Name: NF4462_low_10
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462_low_10 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 313
Target Start/End: Original strand, 42592159 - 42592461
Alignment:
| Q |
11 |
agaagacacattagcgcattcacccaaatcaattggattgctgttaggggagaatttcctgtgaatattgttgtaatcaaggttatgagtaaccctgata |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42592159 |
agaagacacattagcgcattcacccaaatcaattggatttctgttagaggagaatttcctgtgaatattgttgtaatcaaggttatgagtagccctgata |
42592258 |
T |
 |
| Q |
111 |
taccaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacttctgccagccttcgcaattgcttgcaatgcactgaaacatgtgatgga |
210 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| || || ||||||||||||||||| || |
|
|
| T |
42592259 |
taccaactgtcagttgaagttgaatgaacttttgaatattgtgatattcacttctgccagccttcacaattggtttcagcgcactgaaacatgtgataga |
42592358 |
T |
 |
| Q |
211 |
tataccagatctctctctactatcaaatgttctgctaaaaaagttatgaattattcctacatcagctagctttagaacttctgaagtatgattagtcatc |
310 |
Q |
| |
|
|| |||||| | |||||||||| ||| | | |||| | | ||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42592359 |
taaaccagaaccctctctactaccaattaatttgcttagagagttatgaactattcctgcatcagctatctttagaacttctgaagtatgattagtcatc |
42592458 |
T |
 |
| Q |
311 |
aac |
313 |
Q |
| |
|
||| |
|
|
| T |
42592459 |
aac |
42592461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 11 - 204
Target Start/End: Complemental strand, 4092617 - 4092424
Alignment:
| Q |
11 |
agaagacacattagcgcattcacccaaatcaattggattgctgttaggggagaatttcctgtgaatattgttgtaatcaaggttatgagtaaccctgata |
110 |
Q |
| |
|
||||| ||||||||| |||| | |||||||| ||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4092617 |
agaaggcacattagcacatttatccaaatcatttggattgctgttagaggagaatttcctgtgaaaattgttgtaatcaaggttatgagtaaccctgata |
4092518 |
T |
 |
| Q |
111 |
taccaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacttctgccagccttcgcaattgcttgcaatgcactgaaacatgt |
204 |
Q |
| |
|
| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||| || |||||||||||||||||| |
|
|
| T |
4092517 |
tgctaactgtcagctgaagttgaatgaacttttgaatattgtgatatttacgtctgccggccttcacaattggttccaatgcactgaaacatgt |
4092424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0086 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 29 - 57
Target Start/End: Original strand, 29516 - 29544
Alignment:
| Q |
29 |
ttcacccaaatcaattggattgctgttag |
57 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29516 |
ttcacccaaatcaattggattgctgttag |
29544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University