View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462_low_12 (Length: 320)
Name: NF4462_low_12
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 19 - 306
Target Start/End: Complemental strand, 36604966 - 36604677
Alignment:
| Q |
19 |
aagggtttatcaaataagattttcagtgatttttgtaaaatttattcctttagattgagtttgaatttaagtgatttatgttttgatgtgtgaaattttc |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604966 |
aagggtttatcaaatgagattttcagtgatttttgtaaaattgattcctttagattgagtttgaatttaagtgatttatgttttgatgtgtgaaattttc |
36604867 |
T |
|
| Q |
119 |
agtggaagacaannnnnnnnnnnn--gattacttatagttaaattgagctttggaataatcaattttgattcatatgaccgtatgtttgacattgaggca |
216 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36604866 |
agtggaagacaattttttttttttttgattacttatagttaaatcgagctttggaataatcaattttgattcatatgaccgaatgtttgacattgaggca |
36604767 |
T |
|
| Q |
217 |
aaattgtggtgaacatgccttaaaaacaggatttttatggtttctggcatggaagattccaatcatgcttctgttttttgtctcgtgatg |
306 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36604766 |
aaattgtggtgaacatgtcttaaaaacaggatttttatggtttctggcatggaagattccaatcatgcttctgttttttgtctcgtgatg |
36604677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University