View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462_low_14 (Length: 262)
Name: NF4462_low_14
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 12 - 253
Target Start/End: Complemental strand, 36680411 - 36680165
Alignment:
| Q |
12 |
atgatataagacaactatactccttctattttatatctttaattgttttggattatatttttattt-----gaaaacaattggtgttctagaattccaaa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36680411 |
atgatataagacaactatactccttctattttatatctttaattgttttggattatatttttattttatttgaaaacaattggtgttctagaattccaaa |
36680312 |
T |
 |
| Q |
107 |
gtttgatttatatttacnnnnnnnagctttgccctaagactctttgtattgaataaaaagtagaattaactaaccataaaattaagagtattttatgttt |
206 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36680311 |
gtttgatttatatttactttttttagctttgccctaagactctttgtattgaataaaaagtagaattaactaaccataaaactaagagtattttatgttt |
36680212 |
T |
 |
| Q |
207 |
catcttgtgttactagatgcttaaatatcttgattaagttgatgatg |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36680211 |
gatcttgtgttactagatgcttaaatatcttgattaagttgatgatg |
36680165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University