View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462_low_16 (Length: 243)
Name: NF4462_low_16
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 37722815 - 37723039
Alignment:
| Q |
1 |
actattattattaccatgttcagctttatactatgttcnnnnnnnnnatttcattatattatatactatggtttttcatttgtaaagattattgtgttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37722815 |
actattattattaccatgttcagctttatactatgttcttttttttggtttcattatattatatactatggtttttcatttgtaaagattattgtgttat |
37722914 |
T |
|
| Q |
101 |
gtgttcttagtcaaaatacgtctagccacgtattcttgtaatctttttcttcatactctgagcatatgctacttacttatttaacttcatagttagaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37722915 |
gtgttcttagtcaaaatacgtctagccacgtattcttgtaatc-ttttcttcatactctgagcatatgctacttacttatttaacttcatagtcagaatt |
37723013 |
T |
|
| Q |
201 |
tttaagaataatatgcctggacattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
37723014 |
tttaagaataatatgcctggacattt |
37723039 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University