View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4462_low_3 (Length: 448)
Name: NF4462_low_3
Description: NF4462
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4462_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 1e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 321 - 438
Target Start/End: Complemental strand, 38723105 - 38722988
Alignment:
| Q |
321 |
actcttctagagtgtgtttggtcgtttacattgcctaagcatttgtgcagattatgtgcgtttttgatcgtgttattaatggattggttgacttgtgaag |
420 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38723105 |
actcttctagagtgtgtttggtcgtttacattgcctaagcatttgtgcagattatgtgcgtttttgatcgtggtattaatggattggttgacttgtgaag |
38723006 |
T |
 |
| Q |
421 |
gtggaattattacctatg |
438 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38723005 |
gtggaattattacctatg |
38722988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 20 - 131
Target Start/End: Complemental strand, 38723406 - 38723295
Alignment:
| Q |
20 |
gtagactcattgctggttctcacaacaggaacgagtttgttctcatcaatgctgaagaaaatggaagggtaccctctcttttcatttcacatcttatctt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38723406 |
gtagactcattgctggttctcacaacaggaacgagtttgttctcatcaatgctgaagaaaatggaagggtaccctctcttttcatttcacatcttatctt |
38723307 |
T |
 |
| Q |
120 |
aattttgtaggg |
131 |
Q |
| |
|
|||||||||||| |
|
|
| T |
38723306 |
aattttgtaggg |
38723295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University