View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4463_low_5 (Length: 210)

Name: NF4463_low_5
Description: NF4463
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4463_low_5
NF4463_low_5
[»] chr7 (1 HSPs)
chr7 (3-201)||(25594866-25595064)


Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 3 - 201
Target Start/End: Complemental strand, 25595064 - 25594866
Alignment:
3 gggtcatcgtgacggtgacggaatcaaaactgagaacggtgttttaacgtaacggtgacggaattgatcggagtgttcgtgtaaataagttcgcgggaag 102  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25595064 gggtcatcgtgacggtgacggaatcgaaactgagaacggtgttttaacgtaacggtgacggaattgatcggagtgttcgtgtaaataagttcgcgggaag 25594965  T
103 aatgtctagatgcttcgaggctttatatgctgtcgttgtatgacgtggcactttgatgtgtcaccacgcatactgaccaatcatatttcagagtttctt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25594964 aatgtctagatgcttcgaggctttatatgctgtcgttgtatgacgtggcactttgatgtgtcaccacgcatactgaccaatcatatttcagagtttctt 25594866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University