View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464-Insertion-19 (Length: 293)
Name: NF4464-Insertion-19
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464-Insertion-19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 8 - 290
Target Start/End: Original strand, 52449450 - 52449731
Alignment:
| Q |
8 |
gaaaatacacacacggtggaaattttcatctcaccgttcaggcgctgaatttacttgctgcgaatgccaagcataaggtatggcttaaaccacaatctga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52449450 |
gaaaatacacacacggtggaaattttcatctcaccgttcaggcgctgaatttacttgctgcgaatgccaagcataaggtatggcttaaaccacaatctga |
52449549 |
T |
 |
| Q |
108 |
gatgtcgtttttgtatgggaatcatgtgttgaagagtgcgttgggtcggattacggagaatattgtttctggtgatggcgttgttgttttttctatggct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || |
|
|
| T |
52449550 |
gatgtcgtttttgtatgggaatcatgtgttgaagagtgcgttgggtcggattacggagaatattgtttctggtgatggggttgttgttttttctatgtct |
52449649 |
T |
 |
| Q |
208 |
gatgtgcctttggggtttggggtggctgctaagtctacacaggattgtagggaagttggatcctaatggtattgttgtgcttc |
290 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
52449650 |
gatgtgcctttgggttttggggtggctgctaagtctacacaggattgta-ggaagttggatcctaatggtattgttgtgcttc |
52449731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University