View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464-Insertion-24 (Length: 171)
Name: NF4464-Insertion-24
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464-Insertion-24 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 6e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 6e-88
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 39956532 - 39956369
Alignment:
| Q |
8 |
ccttcccctggaggagttgcttactctccatcggattcttcattaccaacaattccttcaagtcctagccctccaaatccagatatctcaactcatcaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956532 |
ccttcccctggaggagttgcttactctccatcggattcttcattaccaacaattccttcaagtcctagccctccaaatccagatatctcaactcatcaag |
39956433 |
T |
|
| Q |
108 |
gtcctgtttcggcttttccaccatccgagtctatgccaccggctttaggcccttcttctcaggg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39956432 |
gtcctgtttcggcttttccaccatccgagtctatgccaccggctttaggcccttcttctcaggg |
39956369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University