View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_high_32 (Length: 242)
Name: NF4464_high_32
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_high_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 15070648 - 15070866
Alignment:
| Q |
1 |
aaaaggcaacttcaaggataaagaaaatgaatgggatgtgcgattatatcttatatcttatctcattgatatatattgacatgttaaaaaaggataaata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15070648 |
aaaaggcaacttcaaggataaagaaaatgaatgggatgtgcgattatatcttatatcttatctcattgatatatattgacatgttaaaaatggataaata |
15070747 |
T |
|
| Q |
101 |
ttaaatacatttaataataattaatgtatctagttgatccttatatcttgttggcaaatatcgacaactatgagacaataagttatagtattaaggttct |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15070748 |
ttaaatacatt---caataattaatgtatctagttgatccttatatcttgttggcaaatatcgacaactatgagacaataagttatagtattaaggttct |
15070844 |
T |
|
| Q |
201 |
tcgtaaggatattgacatagaa |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15070845 |
tcgtaaggatattgacatagaa |
15070866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University