View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_high_39 (Length: 238)
Name: NF4464_high_39
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_high_39 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 88 - 238
Target Start/End: Complemental strand, 14415579 - 14415429
Alignment:
| Q |
88 |
ttgattttgatttggactatggatttggatctggacttactgttgatgatcaagaacaaaaactggtagatgatgaaaagcaaaacccaaagactgggtt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14415579 |
ttgattttgatttggactatggatttggatctggacttactgttgatgatcaagaacaaaaactggtagatgatgaaaagcaaaacccaaagactgggtt |
14415480 |
T |
 |
| Q |
188 |
tgataaaggtcatcttaagcaagggttctatagcgaaagttgtccaactgc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14415479 |
tgataaaggtcatcttaagcaagggttctatagcgaaagttgtccaactgc |
14415429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 14415649 - 14415615
Alignment:
| Q |
18 |
ttcttgtttagcttggtcgttgttcctacaaattc |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14415649 |
ttcttgtttagcttggtcgttgttcctacaaattc |
14415615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University