View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_high_41 (Length: 235)
Name: NF4464_high_41
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_high_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 40741177 - 40741377
Alignment:
| Q |
19 |
aggagtatgtcgaaaaacaagtccaaaaaggcagatcataatgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttatgaaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40741177 |
aggagtatgtcgaaaaacaagtccaaaaaggcagatcataatgcttggttaaagtttttcaaagaggggttagaagcagaaagtgacaaactttttgaaa |
40741276 |
T |
 |
| Q |
119 |
ttgagcatgtgggttttctttgtttatggttatcaaggttcgtttttccttcattttctgattctgttatcgacccgcgtgtttttccaattgctattca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40741277 |
ttgagcatgtgggttttctttgtttatggttatcaaggtttgtttttccttcattttctgattctgttatcgacccgcgtgtttttccaattgctattca |
40741376 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
40741377 |
t |
40741377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University