View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_high_45 (Length: 226)
Name: NF4464_high_45
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_high_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 17774559 - 17774771
Alignment:
| Q |
1 |
gatcttgacctaaatgattggatccattttcgcatcaattttctccctttctcttcccttcttccggtagcttcctctgatggactcatctacctttggg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17774559 |
gatcttgacctaaatgattggatccattttcccctcaactttctccctttctcttcccttcttccagtagcttcctctgatggactcatctacctttggg |
17774658 |
T |
 |
| Q |
101 |
cagaaggtatcaacaatagtccaatctcccaaactctaaccacgacatccctcatcgcttgtaacccactaacacgccaattccggattcatcctccttg |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17774659 |
cagaaggtattaacaatagtccaatctcccaaactctaaccacgacatccctcgtctcttgtaacccactaacacgccaattccggatccatcctccttg |
17774758 |
T |
 |
| Q |
201 |
tccacctggtttc |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
17774759 |
tccacctggtttc |
17774771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 10 - 101
Target Start/End: Complemental strand, 12225482 - 12225391
Alignment:
| Q |
10 |
ctaaatgattggatccattttcgcatcaattttctccctttctcttcccttcttccggtagcttcctctgatggactcatctacctttgggc |
101 |
Q |
| |
|
|||||| ||||| | ||||||| |||| || |||||||||||||| | |||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
12225482 |
ctaaatcattggcttcattttcctctcaacttcctccctttctcttctcctcttccagttgcttcatctcatggactcatctacctttgggc |
12225391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University