View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_high_8 (Length: 431)
Name: NF4464_high_8
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_high_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 23 - 397
Target Start/End: Original strand, 9499671 - 9500044
Alignment:
| Q |
23 |
tgcgtgaccgttatttcatcaggcatgtaaaatggggaattacttccccacttctgcatgacccacctatggtgtcctatcatttttgtggatcccccac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499671 |
tgcgtgaccgttatttcatcaggcatgtaaaatggggaattacttccccatttctgcatgacccacctatggtgtcctatcatttttgtggatcccccac |
9499770 |
T |
 |
| Q |
123 |
tcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499771 |
tcctctaagggtttgaaccaaagcctctcccatcaccaacccccactttttatgaaggccttattccactccaccatttgttgcctactttcaatttctg |
9499870 |
T |
 |
| Q |
223 |
tacatggtttgttattgtctgctagaatattatggcgtcgtttgatccacttagtgggataaggctaggttgttgtttattactgtttgctgaccgttct |
322 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9499871 |
tacatggtctgttattgtctgctagaatattatggcgtcgtttgatccactcagtgggataaggctaggttgttgtttattactgtctgctgaccgttct |
9499970 |
T |
 |
| Q |
323 |
ggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctgtttttgcataactt |
397 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
9499971 |
ggtatgttgctggccatccctcccactgttcttttttcacatgtcagtgagctttgttctg-ttttgcataactt |
9500044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University