View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_23 (Length: 305)
Name: NF4464_low_23
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 4e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 86 - 295
Target Start/End: Original strand, 45645808 - 45646013
Alignment:
| Q |
86 |
ataaagaaaataatacgtgtcatatcttgtttggtcgaacggaggtatatgcacactaaaaatcactatatagtgtataaaatatttaatttggaattct |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45645808 |
ataaagaaaataatacgtgtcatatcttgtttggtcgaacggaggtatatgcacactaaaaatcactatatagtgtataaaatatttaatttggaattct |
45645907 |
T |
 |
| Q |
186 |
atttacactttt-cattgtctacagtgcctgaatcaattatggtaataannnnnnngggtcaaagttatgataatggattttaactactcatattgactg |
284 |
Q |
| |
|
|||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
45645908 |
atttacactttttcattg-----agtgcctgaatcaattatggtaataatttttttgggtcaaagttatgataatggattttaactactcatattgaccg |
45646002 |
T |
 |
| Q |
285 |
catttattcat |
295 |
Q |
| |
|
||||||||||| |
|
|
| T |
45646003 |
catttattcat |
45646013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University