View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_24 (Length: 300)
Name: NF4464_low_24
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 7 - 285
Target Start/End: Complemental strand, 22684453 - 22684181
Alignment:
| Q |
7 |
atatggaataaaaacatatttgtctctccaaaacgtttagataagtacagatccatacctccgaattccagcacccagatagaaatgaaaagctcaataa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22684453 |
atatggaataaaaacatatttgtctctccaaaaagtttagataagtccagatccatacctctgaattccagcacccggatagaaatgaaaagctcaataa |
22684354 |
T |
|
| Q |
107 |
aaaatcatactaaatttaatgaaatgaaacgacaagctgttgcagcatcagataaccctcaaagcttctgtcttagcacaaggcataaagtaatattttc |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||| |||| |
|
|
| T |
22684353 |
aaaatcatactaaatttaatgaaatgaaacgacaagctgttgcggcatcagataaccctcaaatcttctgtcttagcacaacacataaagtaatactttc |
22684254 |
T |
|
| Q |
207 |
cattccatttccataacaatatcatgataaatgaatgtattctaaaacattatcatcttcatttatctattattttcat |
285 |
Q |
| |
|
|| || ||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
22684253 |
ca------tttcataagaatatcatgataaatgaatgtattctaaaacatcatcatcttcatttatctattattttcat |
22684181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University