View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_25 (Length: 289)
Name: NF4464_low_25
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_25 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 25 - 289
Target Start/End: Complemental strand, 27111553 - 27111289
Alignment:
| Q |
25 |
tagtagcgacggtggtgatagaagcggtttcacggtggttgtagccatgactggtaattagctacgaactgtacttggtagcttcgggtaagttccgaag |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
27111553 |
tagtagcgacggtggtgatagaagcggtttcacggtggttgtagccatgaccggtaattagctacgaactgtactcggtagcttcgggtaagttccgaag |
27111454 |
T |
 |
| Q |
125 |
ttgactcttcgctttgggctggttgattgaactgaggatatgtggcccattaatattcggtttgtaagagaatctcaattttcgcttggatggtatggta |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27111453 |
ttgactcttcgctttgggctggttgattgaactgaggatatgtggcccattaatattcggtttgtaagagaatctcaattttcgcttggatggtatggta |
27111354 |
T |
 |
| Q |
225 |
acgattagagtattcacggtgcgggttggtttgagggtaaaaatcatttgaaccgcaagataaaa |
289 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
27111353 |
acgattagagtattcacggtgcggtttggtttgaggataaaaatcatctgaaccgcaagataaaa |
27111289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University