View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_33 (Length: 255)
Name: NF4464_low_33
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 37398225 - 37397972
Alignment:
| Q |
1 |
tttgataaaagtgaattttttaaccaacaaactacgtgaccaaaaaattt-aaatttgctccacacacattcaaagttttt---------atccaaatga |
90 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| |||||||||||||| |||||||||||||||||||||||||||| | || ||||| |
|
|
| T |
37398225 |
tttgataaaagtgaatttt--aaccaacagactacatgaccaaaaaatttgaaatttgctccacacacattcaaagtttcttaaaaacatattgaaatgg |
37398128 |
T |
|
| Q |
91 |
tgcaaatatccc-gacggtataactaccgttgcctttcttcaaatattgacagcaatttgcatgtttaaaaaacattcatttgataaatttttaaaaatc |
189 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37398127 |
tgcaaatatccccgacggtataactaccgttgcctttcttcaaatattgacagcaatttgcatttttaaaaaacattcatttgataaatttttaaaaatc |
37398028 |
T |
|
| Q |
190 |
ataacttacaaaatacacaattgcgtaaaactaattaagttttaatttcatctctg |
245 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
37398027 |
ataacttacaaaaaacacaattgcgtaaaactaaattagttttaatttcatctctg |
37397972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University