View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_34 (Length: 253)
Name: NF4464_low_34
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 2479446 - 2479688
Alignment:
| Q |
1 |
taattagctatccagcggcatcacaagtgaaataagtcatttcaaacacaggctcagttaatttgttagtttcatttttactgatgttaatattttcttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2479446 |
taattagctatccagcggcatcacaagtgaaataagtcatttcaaacacaggctcagttaatttgttagttccatttttactgatgttaatattttcttt |
2479545 |
T |
 |
| Q |
101 |
gaaacacgttttgagaacagaagatgtattcaaagatcttgttgggagtgcatattatgttgctcctgaggtgttgcgtagaagctatggacctgaggct |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2479546 |
gaaacactttttgagaacagaagatgtattcaaagatcttgttgggagtgcatattatgttgctcctgaggtgttgcgtagaagctatggacctgaagct |
2479645 |
T |
 |
| Q |
201 |
gatatttggagtgctgggattattttgtacattctcctctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2479646 |
gatatttggagtgctgggattattttgtacattctcctctctg |
2479688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 132 - 211
Target Start/End: Complemental strand, 41622614 - 41622535
Alignment:
| Q |
132 |
aaagatcttgttgggagtgcatattatgttgctcctgaggtgttgcgtagaagctatggacctgaggctgatatttggag |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||| | ||| ||||| ||||| ||||||||||||| |
|
|
| T |
41622614 |
aaagatcttgttgggagtgcatattatgttgctcctgaagtgctgcgcaaaagttatgggcctgaaactgatatttggag |
41622535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University