View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_37 (Length: 243)
Name: NF4464_low_37
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_37 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 16 - 243
Target Start/End: Complemental strand, 51319022 - 51318803
Alignment:
| Q |
16 |
caaaaatgttttggtgcaaattgttgatcaggagggaaacaatgttcttcacttggctggaaagtttgtttctaaaggaagatttggatcacctcatata |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51319022 |
caaaaatgttttggtgcaaattgttgatcaggagggaaacaatgttcttcacttggctggaaagtttgtttctaaaggaagatttggatcacctcatata |
51318923 |
T |
|
| Q |
116 |
aatcaagatcttctaattcacagtgatgagtcatggtttaaggtacatgattaccatggcattnnnnnnnnnnnnnnggttttggataagatagtttgtt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51318922 |
catcaagatcttctaattcacagtgatgagtcatggtttaaggtacatgattaccatggcatt--------tatataggttttggataagatagtttgtt |
51318831 |
T |
|
| Q |
216 |
tattaatattgctttaattttaattact |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
51318830 |
tattaatattgctttaattttaattact |
51318803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 51342837 - 51342776
Alignment:
| Q |
20 |
aatgttttggtgcaaattgttgatcaggagggaaacaatgttcttcacttggctggaaagtt |
81 |
Q |
| |
|
|||||||| |||||| | |||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
51342837 |
aatgttttagtgcaacatattgatctcgagggaaacaatattcttcacttggctggaaagtt |
51342776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University