View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4464_low_51 (Length: 230)
Name: NF4464_low_51
Description: NF4464
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4464_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 115 - 167
Target Start/End: Original strand, 7800950 - 7801002
Alignment:
| Q |
115 |
gcttaatatgattttcttgtcctcctccctgaaattagtctctcattaaaaac |
167 |
Q |
| |
|
|||| ||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7800950 |
gcttgatatgtttttcttgtcctcctccctgaaattagtctctcgctaaaaac |
7801002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 164 - 229
Target Start/End: Complemental strand, 8142890 - 8142825
Alignment:
| Q |
164 |
aaacagcttatttgtaatttatagttcaaacgcttattataataagtgtttatgtataagctattt |
229 |
Q |
| |
|
||||| ||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
8142890 |
aaacaacttatttgtaatttataacacaaacatttattacgataagtgtttatgtataagctattt |
8142825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University