View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4465_high_5 (Length: 241)
Name: NF4465_high_5
Description: NF4465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4465_high_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 61 - 234
Target Start/End: Original strand, 52204517 - 52204688
Alignment:
| Q |
61 |
gagcccaaattaatcattttttcaactaaaatctannnnnnnatatttaatttaaagggaaacatgataccccatggatcaatgcagactgattcagttt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52204517 |
gagcccaaattaatcattttttcaactaaaatctatttttttat---taatttatagggaaacatgataccccatggatcaatgcagactgattcagttt |
52204613 |
T |
|
| Q |
161 |
ttcaaaatgggttccagcgggtttggcc-aaaaaactcaaatacttttggtaattattcttctctcatatgtttt |
234 |
Q |
| |
|
||||||||||| | || |||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52204614 |
ttcaaaatgggctttagtgggtttggccaaaaaaactcaaatacttttggtaattattcttctctcatatgtttt |
52204688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 12 - 41
Target Start/End: Original strand, 52204469 - 52204498
Alignment:
| Q |
12 |
tcatcaacaaacaacctttctccgttagcc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
52204469 |
tcatcaacaaacaacctttctccgttagcc |
52204498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University