View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4465_low_3 (Length: 291)
Name: NF4465_low_3
Description: NF4465
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4465_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 2131081 - 2131305
Alignment:
| Q |
11 |
cacagactatactcgcatgcaaggtgtgcgcatcttaggcctccttcacttgacatgttcacttttgacttgcaattgggacttgagacaagattctcct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131081 |
cacagactatactcgcatgcaaggtgtgcgcatcttaggcctccttcacttgacatgttcacttttgacttgcaattgggacttgagacaagattctcct |
2131180 |
T |
|
| Q |
111 |
aaattttatggacttcatatctttgttgtgattttcttcatacttttataacattcacaggacatcttttgatcagatcaaactattggtctataccaaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2131181 |
aaattttatggacttcatatctttgttgtgattttcttcatacttttataacattcacaggacatcttttgatcagatcaaactattggtctataccaaa |
2131280 |
T |
|
| Q |
211 |
aagactaagacaccatatagagttg |
235 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
2131281 |
aagactaagacaccatatagagttg |
2131305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University