View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4466_high_10 (Length: 238)
Name: NF4466_high_10
Description: NF4466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4466_high_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 8176596 - 8176375
Alignment:
| Q |
1 |
tatagcatagcacaaatgtaactaactatgtaatgcc-cgacgagatatgcaggagattgtttgagatcatatgagtggtgcaggttggatgagatgcgc |
99 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8176596 |
tatagcatagcacaactgtaactaactatgtaatgcggcgacgagatatgcaggagattgtttgagatcatatgagtggtgcaggttggatgagatgcgc |
8176497 |
T |
|
| Q |
100 |
ttctgtgcagtgaggcacgcatgaagtcttctatgttttcttgaatgacacggattatcgattaatgtgtagtcatgcattggatctatgatgtgggttg |
199 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
8176496 |
ttctgtgcagtgaggcacgcatgaaatcttctatgttttcttgaatgacgtggattatcggttaatgtgtagtcatgcattggatttgtgatgtgggttg |
8176397 |
T |
|
| Q |
200 |
aggcccattccgaaacaattgc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8176396 |
aggcccattccgaaacaattgc |
8176375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University