View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4466_low_12 (Length: 243)

Name: NF4466_low_12
Description: NF4466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4466_low_12
NF4466_low_12
[»] chr5 (1 HSPs)
chr5 (11-228)||(42591084-42591299)


Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 42591299 - 42591084
Alignment:
11 tttggttaataatagaaaaagtttcatttcaacacaaatagtaagctattgtttgaattcatgctagttcatttcaacactgtgtatgtaatggtgttaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
42591299 tttggttaataatagaaaaagtttcatttcaacacaaatagtaagctattgtttgaattcatgctaggtcatttcaacactgtgtatgtaatggtgttaa 42591200  T
111 aacgatatacaagaaacattgcttttgatatttaaccnnnnnnnnnnnnnnacttatggtactggcatagatgtactgtataccataacttctatccaga 210  Q
    |||||||||||||||||||||||||||||||||||||              |||||||||||||||||||||||||||||||||||||||||||||||||    
42591199 aacgatatacaagaaacattgcttttgatatttaacc--ttttttttttttacttatggtactggcatagatgtactgtataccataacttctatccaga 42591102  T
211 accactaccaaatatgat 228  Q
    ||||||||||||||||||    
42591101 accactaccaaatatgat 42591084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University