View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4466_low_12 (Length: 243)
Name: NF4466_low_12
Description: NF4466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4466_low_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 11 - 228
Target Start/End: Complemental strand, 42591299 - 42591084
Alignment:
| Q |
11 |
tttggttaataatagaaaaagtttcatttcaacacaaatagtaagctattgtttgaattcatgctagttcatttcaacactgtgtatgtaatggtgttaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42591299 |
tttggttaataatagaaaaagtttcatttcaacacaaatagtaagctattgtttgaattcatgctaggtcatttcaacactgtgtatgtaatggtgttaa |
42591200 |
T |
|
| Q |
111 |
aacgatatacaagaaacattgcttttgatatttaaccnnnnnnnnnnnnnnacttatggtactggcatagatgtactgtataccataacttctatccaga |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42591199 |
aacgatatacaagaaacattgcttttgatatttaacc--ttttttttttttacttatggtactggcatagatgtactgtataccataacttctatccaga |
42591102 |
T |
|
| Q |
211 |
accactaccaaatatgat |
228 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42591101 |
accactaccaaatatgat |
42591084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University