View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4466_low_6 (Length: 290)
Name: NF4466_low_6
Description: NF4466
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4466_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 165 - 241
Target Start/End: Complemental strand, 1418744 - 1418668
Alignment:
| Q |
165 |
caatttttagcttttaaacaattcaagtcggttcaacaattcatcaaatatgaaccgattccgaacattatattata |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
1418744 |
caatttttagcttttaaacaattcaagtcggttcaacaattcatcaaatatgaaccggttccgaacattatattata |
1418668 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 1418957 - 1418893
Alignment:
| Q |
18 |
gtgatgaatatagtcagtcatatggtgtcaaaggcaatgtgcattgtgaaagaaatacctaaaat |
82 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1418957 |
gtgatgaatatagtcagtcatatggtgtcaaaggcaatgtgcattgtgaaagaaagacctaaaat |
1418893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University