View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4467-Insertion-8 (Length: 76)
Name: NF4467-Insertion-8
Description: NF4467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4467-Insertion-8 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 42; Significance: 0.000000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.000000000000001
Query Start/End: Original strand, 31 - 76
Target Start/End: Original strand, 48739448 - 48739493
Alignment:
| Q |
31 |
tgaatttaagtatttacgatgattagcacctaaatgaattgataag |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48739448 |
tgaatttaagtatttacgatgattagcagctaaatgaattgataag |
48739493 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University