View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4467_low_7 (Length: 211)

Name: NF4467_low_7
Description: NF4467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4467_low_7
NF4467_low_7
[»] chr3 (3 HSPs)
chr3 (105-199)||(30244143-30244237)
chr3 (1-34)||(30244326-30244359)
chr3 (166-199)||(30244059-30244092)
[»] chr5 (1 HSPs)
chr5 (105-164)||(14671141-14671200)


Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 105 - 199
Target Start/End: Complemental strand, 30244237 - 30244143
Alignment:
Q  105 caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttgattttagttatgttatagttttagggtgtgtttggt 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30244237 caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttgattttagttatgttatagttttagggtgtgtttggt 30244143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30244359 - 30244326
Alignment:
Q  1 ctagtttgtgtttttgattctgtggtgataaaaa 34  Q
    ||||||||||||||||||||||||||||||||||    
T  30244359 ctagtttgtgtttttgattctgtggtgataaaaa 30244326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 199
Target Start/End: Complemental strand, 30244092 - 30244059
Alignment:
Q  166 tttagttatgttatagttttagggtgtgtttggt 199  Q
    |||||||||||| |||||||||||||||||||||    
T  30244092 tttagttatgttgtagttttagggtgtgtttggt 30244059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 164
Target Start/End: Complemental strand, 14671200 - 14671141
Alignment:
Q  105 caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttga 164  Q
    ||||||||||||||| || | ||||||||||||||||||||  || ||||||||| ||||    
T  14671200 caaaaaatgattttgaatgaattgattttgtgaaattgattatggctaaaagtgaattga 14671141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University