View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4467_low_7 (Length: 211)
Name: NF4467_low_7
Description: NF4467
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4467_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 95; Significance: 1e-46; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 105 - 199
Target Start/End: Complemental strand, 30244237 - 30244143
Alignment:
| Q |
105 |
caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttgattttagttatgttatagttttagggtgtgtttggt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30244237 |
caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttgattttagttatgttatagttttagggtgtgtttggt |
30244143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 30244359 - 30244326
Alignment:
| Q |
1 |
ctagtttgtgtttttgattctgtggtgataaaaa |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30244359 |
ctagtttgtgtttttgattctgtggtgataaaaa |
30244326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 199
Target Start/End: Complemental strand, 30244092 - 30244059
Alignment:
| Q |
166 |
tttagttatgttatagttttagggtgtgtttggt |
199 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| |
|
|
| T |
30244092 |
tttagttatgttgtagttttagggtgtgtttggt |
30244059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 105 - 164
Target Start/End: Complemental strand, 14671200 - 14671141
Alignment:
| Q |
105 |
caaaaaatgattttggataagttgattttgtgaaattgattcgggttaaaagtgacttga |
164 |
Q |
| |
|
||||||||||||||| || | |||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
14671200 |
caaaaaatgattttgaatgaattgattttgtgaaattgattatggctaaaagtgaattga |
14671141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University